#	No. in file	Id	Sentence	Columns	A1	A2	A3	A4	A5
1	5345	7559588_100	Figure 5:TrkA autophosphorylation in KCNR cells treated with IFN- . |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
2	6504	12433372_265	First, of the various mast cell markers examined, the IL-3-dependent PU.1 / progenitors express detectable transcripts of only one, mMC CPA. |A1:**1SP3E1+| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E1+	1SP3E0	1SP3E0	1SP3E0	1GP3E3
				Evidence	2	1	1	1	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
3	6712	9620677_97	Some recent data may suggest that this is also true in the human disease (Conrad et al. 1997), |A1:**1GP1E3| |A2:**1SP1E3| |A3:**1GP2E2| |A4:**1GP2E2| |A5:**1GP2E2| although of course in this case it is much more difficult to demonstrate that a certain antigen and certain T cells are indeed the cause of the disease. |A1:**2SP0E0| |A2:**2SP0E0| |A3:**2SP0E0| |A4:**2SP0E0| |A5:**2GP1E0|
				Annotation	1GP1E3 2SP0E0	1SP1E3 2SP0E0	1GP2E2 2SP0E0	1GP2E2 2SP0E0	1GP2E2 2GP1E0
				Evidence	4 1	4 1	3 1	3 1	3 1
				Focus	1 4	4 4	1 4	1 4	1 1
				Polarity	5 4	5 4	6 4	6 4	6 5
4	6794	9862746_178	However, it seems unlikely that the protection is due to inhibition of prolyl endopeptidase activity, |A1:**1SN1E0-| |A2:**1SN1E0-| |A3:**1SN1E0-| |A4:**1SN1E0-| |A5:**1SN1E0-| because this enzymatic activity is unaltered during age induced age-induced apoptosis (data not shown). |A1:**2SP3E1| |A2:**2SP3E3| |A3:**2SP3E3| |A4:**2SP3E3| |A5:**2SP2E3|
				Annotation	1SN1E0- 2SP3E1	1SN1E0- 2SP3E3	1SN1E0- 2SP3E3	1SN1E0- 2SP3E3	1SN1E0- 2SP2E3
				Evidence	1 2	1 4	1 4	1 4	1 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	3 7	3 7	3 7	3 7	3 6
5	8040	10903313_53	The protection of labeled pAPI from proteinase K digestion in the absence or presence of detergent was analyzed in osmotically lysed spheroplasts by autoradiography after immunoprecipitation (see "Experimental Procedures" and the legend to Fig. 5). |A1:**1MSP3E3| |A2:**1MSP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MSP3E3	1MSP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	6	6	2	2	2
				Polarity	7	7	7	7	7
6	1563	11700328_19	Putative transmembrane domains ( ) are highlighted with gray. |A1:**1GP3E2| |A2:**1GP3E0| |A3:**1GP3E0| |A4:**1GP3E0| |A5:**1GP2E3|
				Annotation	1GP3E2	1GP3E0	1GP3E0	1GP3E0	1GP2E3
				Evidence	3	1	1	1	4
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	6
7	2261	12086874_206	Western blotting analysis of primary astrocytes ( K) also demonstrated that P-Akt Ser473 levels were increased in tumor cells (T 1-2) relative to normal cells ( C), |A1:**1SP3E3+| |A2:**1MSP3E3+| |A3:**1MP3E3+| |A4:**1MP3E3+| |A5:**1MP3E3+| while the level of total Akt and p-Erk1,2Thy183/Tyr185 were unchanged. |A1:**2SP3E3| |A2:**2SP3E3| |A3:**2SP3E0| |A4:**2SP3E0| |A5:**2SP3E3|
				Annotation	1SP3E3+ 2SP3E3	1MSP3E3+ 2SP3E3	1MP3E3+ 2SP3E0	1MP3E3+ 2SP3E0	1MP3E3+ 2SP3E3
				Evidence	4 4	4 4	4 1	4 1	4 4
				Focus	4 4	6 4	2 4	2 4	2 4
				Polarity	7 7	7 7	7 7	7 7	7 7
8	1628	11278665_37	It has also been suggested that TRAIL-R could, with the intermediary of FADD, recruit TRADD and activate NF-kappaB in this way (17). |A1:**1SP2E2| |A2:**1SP3E2| |A3:**1SP2E2| |A4:**1SP2E2| |A5:**1SP2E2+|
				Annotation	1SP2E2	1SP3E2	1SP2E2	1SP2E2	1SP2E2+
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	6	7	6	6	6
9	3216	12453426_73	Note that samples in lanes 5/6 and 7/8 were reconstituted with the after-displacement BER substrate and the 5 nt noncomplementary flap substrate, respectively. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
10	9456	9039267_319	This work was supported by the Dutch Cancer Society. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP3E0	1GP3E3	1GP3E3	1GP3E0
				Evidence	1	1	4	4	1
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
11	3680	11841944_564	IC50 measurements were performed in an analogous fashion to that described for the 4-epimerase; compound 1-143 was dispensed to the microplate, a solution containing the dehydrogenase was added, and the solution was incubated at room temperature until the absorbance achieved a stable baseline, and finally the reaction was initiated by the addition of UDP-Glc. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
12	3038	12190174_12	Evaluation of antiplatelet antibodies, using an antigen-specific assay, was useful in supporting this diagnosis. |A1:**1MSP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MSP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	6	2	2	2	2
				Polarity	7	7	7	7	7
13	5793	10428033_224	Since the affinity of cytochrome bd oxidase for oxygen is very high (Km 20 nM - 1 muM), |A1:**1SP3E0+| |A2:**1SP3E0+| |A3:**1SP3E0+| |A4:**1SP3E0+| we carried out our experiments in strains containing null mutations in both cytochrome bd and bo oxidases to avoid trace quantities of oxygen that would allow the flow of electrons through cytochrome bd oxidase. |A1:**2MSP3E3| |A2:**2MSP3E3| |A3:**2MP3E3| |A4:**2MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E0+ 2MSP3E3	1SP3E0+ 2MSP3E3	1SP3E0+ 2MP3E3	1SP3E0+ 2MP3E3	1MP3E3 1MP3E3
				Evidence	1 4	1 4	1 4	1 4	4 4
				Focus	4 6	4 6	4 2	4 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
14	30	10721990_248	Here we show that WNT-7a, secreted by GCs, plays a role in this process. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
15	9117	12193063_5	No interconversion of the two forms was detected after purification. |A1:**1GN3E3| |A2:**1MN3E3| |A3:**1GN3E3| |A4:**1GN3E3| |A5:**1GN3E3|
				Annotation	1GN3E3	1MN3E3	1GN3E3	1GN3E3	1GN3E3
				Evidence	4	4	4	4	4
				Focus	1	2	1	1	1
				Polarity	1	1	1	1	1
16	8304	9882705_153	As shown in Fig. 6, 1-h pretreatment of cells with 25 muM PhoCho or DiC8 inhibited by 30% DNA fragmentation |A1:**1MSN3E3| |A2:**1SN3E3-| |A4:**1SP3E3-| induced by 1 muM DNR and MXT. |A1:**2SP3E3| |A2:**2SP3E3| |A3:**1MP3E3| |A4:**2SP3E3| |A5:**1MP3E3-|
				Annotation	1MSN3E3 2SP3E3	1SN3E3- 2SP3E3	1MP3E3 1MP3E3	1SP3E3- 2SP3E3	1MP3E3- 1MP3E3-
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	6 4	4 4	2 2	4 4	2 2
				Polarity	1 7	1 7	7 7	7 7	7 7
17	7814	11274124_37	The root and the stem were checked for the efficacy of sterilization by rolling them on 0.1% tryptic soy agar (TSA) plates. |A1:**1MSP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MSP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	6	2	2	2	2
				Polarity	7	7	7	7	7
18	9033	11861801_19	At least 14 members of the caspase family have been identified (Van de Craen et al., 1998). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SGP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SGP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	5
				Polarity	7	7	7	7	7
19	4167	11114897_101	Other data obtained in the course of characterizing this mutant's biochemical activity in crude extracts |A5:**1GP3E3| suggested that the T124I mutant may also accumulate cleaved substrate molecules even under recombination conditions (data not shown). |A5:**2SP2E3| |A1:**1SP2E1| |A2:**1SP2E3| |A3:**1SP3E3| |A4:**1SP3E3|
				Annotation	1SP2E1 1SP2E1	1SP2E3 1SP2E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1GP3E3 2SP2E3
				Evidence	2 2	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	1 4
				Polarity	6 6	6 6	7 7	7 7	7 6
20	2656	10877790_113	The analysis indicated that the sandy loam rhizosphere (C1) and interspace (C0) soil communities at Cosnino were the most similar in composition, |A1:**1SP3E3| whereas the cinders interspace (S0) community was the most different. |A1:**2SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3 2SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1GP3E3 1GP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
21	7526	9843507_145	This gap is lost in dCtBP mutants (Figure 3D), |A4:**1SP2E3-| |A5:**1SP3E3-| similar to the situation observed in knirps- embryos (Arnosti et al., 1996). |A4:**2SP3E2| |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E3| |A5:**1SP3E2|
				Annotation	1SP3E23 1SP3E23	1SP3E23 1SP3E23	1SP3E3 1SP3E3	1SP2E3- 2SP3E2	1SP3E3- 1SP3E2
				Evidence	3 3	3 3	4 4	4 3	4 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	6 7	7 7
22	990	10956650_12	It is likely that this difference reflects the amount of annexin molecules bound per unit amount of phospholipid surface area or curvature. |A1:**1GP2E1| |A2:**1SP2E1| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP1E0|
				Annotation	1GP2E1	1SP2E1	1SP2E0	1SP2E0	1GP1E0
				Evidence	2	2	1	1	1
				Focus	1	4	4	4	1
				Polarity	6	6	6	6	5
23	3596	10805799_15	Presumably through interactions with surface membrane-associated VH3-encoded B-cell antigen receptors (11), |A2:**1SP3E2| |A5:**1SP2E2| in vitro stimulation with SpA can contribute to selection of these B cells |A1:**1SP3E2| and promote their production of antibodies that may include rheumatoid factor autoantibodies ( 12, 13). |A1:**2SP1E2+| |A2:**2SP2E2+| |A3:**1SP2E2| |A4:**1SP2E2| |A5:**2SP3E2+|
				Annotation	1SP3E2 1SP3E2 2SP1E2+	1SP3E2 2SP2E2+ 2SP2E2+	1SP2E2 1SP2E2 1SP2E2	1SP2E2 1SP2E2 1SP2E2	1SP2E2 2SP3E2+ 2SP3E2+
				Evidence	3 3 3	3 3 3	3 3 3	3 3 3	3 3 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 5	7 6 6	6 6 6	6 6 6	6 7 7
24	3511	9390512_37	As it happens, prevalence of a disease is also affected by its mode of inheritance, as is nicely demonstrated in the case of maturity onset-type diabetes of youth (MODY) and insulin-dependent diabetes mellitus (IDDM). |A1:**1GP3E3| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1SP3E1	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	2	4	4	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
25	3772	12887906_155	Although rad55 strains did allow delayed but extensive Rad51p association with MAT, |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E3+| they failed to exhibit an association of Rad51p with the HML donor (Figures 6A and 6C) |A1:**2SN3E3| |A2:**2SN3E3| |A3:**2SP3E3| |A4:**2SP3E3| |A5:**2SP3E3-|
				Annotation	1SP3E3 2SN3E3	1SP3E3 2SN3E3	1SP3E0 2SP3E3	1SP3E0 2SP3E3	1SP3E3+ 2SP3E3-
				Evidence	4 4	4 4	1 4	1 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 1	7 1	7 7	7 7	7 7
26	2746	11606579_43	We would like to propose that the negative charge introduced by the BH group at the Pro- Rp position (Fig. 1) becomes the driving force for PPi release. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP2E3	1SP2E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	6	6	7
27	6641	11340075_128	Because most wild type IC expressing wild-type IC-expressing cells displayed a partial phenotype, |A1:**1GP3E0| we also examined the effects of S84A and S84D mutant expression on late endosome-lysosome distribution. |A1:**2SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1GP3E0 2SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3
				Evidence	1 4	4 4	4 4	4 4	4 4
				Focus	1 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
28	6215	10671457_11	Removal of the 40 C-terminal amino acids, residues 247 to 286, of FAEXynZ resulted in protein without activity. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GN3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GN3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	1
29	4905	9573199_70	Recombination substrates were prepared by linearizing cosmid pYUB325 with PacI (New England Biolabs), |A5:**1MP3E3| which releases the chromosomal sequences as a single fragment. |A5:**2GP3E0| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1MP3E3 2GP3E0
				Evidence	4 4	4 4	4 4	4 4	4 1
				Focus	4 4	4 4	2 2	2 2	2 1
				Polarity	7 7	7 7	7 7	7 7	7 7
30	1555	10581284_244	Graphs corresponding to Figure 3 for WL are not shown, |A3:**1SN3E3| |A4:**1SN3E3| |A5:**1GN3E3| but the chi2 values for each of the models are shown in Table 4. |A3:**2SP3E3| |A1:**1GP3E3| |A2:**1GP3E3| |A4:**2SP3E3| |A5:**2GP3E3|
				Annotation	1GP3E3 1GP3E3	1GP3E3 1GP3E3	1SN3E3 2SP3E3	1SN3E3 2SP3E3	1GN3E3 2GP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	1 1	1 1	4 4	4 4	1 1
				Polarity	7 7	7 7	1 7	1 7	1 7
31	6095	10523308_185	It is possible that the motif1-hairpin and flanking sequences cannot function as an independent promoter |A5:**1SN2E0| because it lacks sequences capable of directing de novo initiation of RNA synthesis. |A5:**2SN3E0| |A1:**1SN3E0| |A2:**1SN2E0| |A3:**1SN3E0| |A4:**1SN3E0|
				Annotation	1SN3E0 1SN3E0	1SN2E0 1SN2E0	1SN3E0 1SN3E0	1SN3E0 1SN3E0	1SN2E0 2SN3E0
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	2 2	1 1	1 1	2 1
32	5441	9892664_13	Among these, ZO-1, ZO-2, and ZO-3 are related to each other and belong to the membrane-associated guanylate kinase homologues gene family, which contains PDZ, SH3, and GUK (guanylate kinase-like) domains (17-19). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
33	3806	11287622_79	Primers 2571 (5''-CGCTCTCGGCCGAAGGACATC) and 2572 (5''-TCAACGATGTAAAAGAAGTCACCG) were used in a PCR reaction with genomic DNA from the serotype A strain H99 as template. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
34	8470	12125819_4	The expression of lipA and nadAB, which are involved in lipoic acid synthesis and NAD synthesis, respectively, |A5:**1GP3E1| was found to be reduced in the cells overproducing Era-dE. |A5:**2GP3E3-| |A1:**1SP3E3| |A2:**1SP3E3-| |A3:**1SP3E3+| |A4:**1SP3E3+|
				Annotation	1SP3E3 1SP3E3	1SP3E3- 1SP3E3-	1SP3E3+ 1SP3E3+	1SP3E3+ 1SP3E3+	1GP3E1 2GP3E3-
				Evidence	4 4	4 4	4 4	4 4	2 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
35	6993	10698942_456	Laurent, M.N. , M.N., Blitz, I.L. , I.L., Hashimoto, C. , C., Rothbacher, U. and Cho, K.W. (1997) |A3:**1GP3E3| |A4:**1GP3E2| |A5:**1GP3E2| The Xenopus homeobox gene twin mediates Wnt induction of goosecoid in establishment of Spemann's organizer. |A3:**2SP3E0| |A1:**1SP3E3| |A2:**1SP3E2| |A4:**2SP3E0| |A5:**2SP3E0+|
				Annotation	1SP3E3 1SP3E3	1SP3E2 1SP3E2	1GP3E3 2SP3E0	1GP3E2 2SP3E0	1GP3E2 2SP3E0+
				Evidence	4 4	3 3	4 1	3 1	3 1
				Focus	4 4	4 4	1 4	1 4	1 4
				Polarity	7 7	7 7	7 7	7 7	7 7
36	7587	10480939_34	0.5 mug of GST54, 0.5 mug of cpSRP43, or 3.4 muCi of cpSRP54his (~0.2 mug) were mixed as indicated, purified on glutathione-Sepharose, subjected to SDS-PAGE, electrophoretically transferred to nitrocellulose, and analyzed by radioimaging ( lower panel) and immunoblotting ( upper panel) with antibodies against cpSRP54 and cpSRP43 as described under "Experimental Procedures." |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3| Arabidopsis Contains a Chloroplast Homologue of Bacterial FtsY-- An alignment of the Arabidopsis FtsY homologue with related sequences is shown in Fig. 3. |A1:**2MP3E3| |A2:**2SP3E3| |A3:**2SP3E3| |A4:**2SP3E3| |A5:**2SP3E3| High similarity among all sequences is observed in the C terminus containing the GTP-binding and hydrolysis domains. |A1:**3SP3E3| |A2:**3SP3E3| |A3:**3SP3E0| |A4:**3SP3E0| |A5:**3GP3E1|
				Annotation	1MP3E3 2MP3E3 3SP3E3	1MP3E3 2SP3E3 3SP3E3	1MP3E3 2SP3E3 3SP3E0	1MP3E3 2SP3E3 3SP3E0	1MP3E3 2SP3E3 3GP3E1
				Evidence	4 4 4	4 4 4	4 4 1	4 4 1	4 4 2
				Focus	2 2 4	2 4 4	2 4 4	2 4 4	2 4 1
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
37	4337	11159990_229	The number of histidine and tyrosine residues in these proteins, including those contained within the histidine triad motif, suggests that they may be involved in metal or nucleoside binding. |A1:**1SP1E1| |A2:**1SP2E1| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1SP2E1|
				Annotation	1SP1E1	1SP2E1	1SP2E0	1SP2E0	1SP2E1
				Evidence	2	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	5	6	6	6	6
38	6786	12414801_118	As shown in Fig. 6 A, mutation of the MIP 3alpha MIP-3alpha promoter at either position reduced IL-1beta-mediated luciferase activity by ~75% ( p < 0.01) compared with the wild-type control. |A1:**1SP3E3-| |A2:**1SP3E3-| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3-|
				Annotation	1SP3E3-	1SP3E3-	1SP3E3	1SP3E3	1SP3E3-
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
39	4159	9797273_61	Protein concentrations (15 mug) were estimated by the method of Lowry et al. (16), |A1:**1MP3E2| |A2:**1SP3E23| |A3:**1MP3E2| |A4:**1MP3E2| |A5:**1MP3E2| and proteins were separated through a sodium dodecyl sulfate (SDS)-15% polyacrylamide minigel at 100 V with the Mini-Protean II apparatus (Bio-Rad Laboratories, Mississauga, Ontario, Canada). |A1:**2MP3E2| |A2:**1MP3E3| |A3:**2MP3E3| |A4:**2MP3E3| |A5:**2SP3E3|
				Annotation	1MP3E2 2MP3E2	1SP3E23 1MP3E3	1MP3E2 2MP3E3	1MP3E2 2MP3E3	1MP3E2 2SP3E3
				Evidence	3 3	3 4	3 4	3 4	3 4
				Focus	2 2	4 2	2 2	2 2	2 4
				Polarity	7 7	7 7	7 7	7 7	7 7
40	2872	10330411_74	The reaction mixture containing the [35] methionine- or [35]cysteine- (in vitro translation grade; ICN) labeled proteins was clarified by centrifugation before incubation with GST fusion proteins in fusion protein binding buffer for 120 min at 4 degrees C as described above. |A2:**1MP3E3| |A1:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E2|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E2
				Evidence	4	4	4	4	3
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
41	889	9658201_148	In the more recent model (Haskell-Luevano et al., 1996), MTII, |A3:**1SP3E2| |A4:**1SP3E2| a cyclic lactam analogue, and the core tripeptide (D-Phe)-Arg-Trp were docked, and amino acids in all TM regions were identified as possible contact points. |A3:**2SP2E3| |A1:**1SP3E2| |A2:**1SP3E2| |A4:**2SP2E3| |A5:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 2SP2E3	1SP3E2 2SP2E3	1SP3E2 1SP3E2
				Evidence	3 3	3 3	3 4	3 4	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 6	7 6	7 7
42	5516	9889191_237	In order to investigate further the role of porin in Neisseria-induced apoptosis, |A5:**1GP3E0| we tested several isogenic gonococcal strains producing recombinant porins, |A4:**1SP3E0| i.e. Ngo MS11 synthesizing PorBIA of strain VP1 (MS11 PorBIA), MS11 PorBIB synthesizing the authentic PorBIB, MS11 PorB Nla synthesizing a Neisseria lactamica PorB, and MS11 PorBdeltaloop1 synthesizing a mutant MS11 PorB with a deletion in loop 1 (Bauer et al., 1999). 1999). |A4:**2SP3E2| |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E2| |A5:**2SP3E23|
				Annotation	1SP3E23 1SP3E23 1SP3E23	1SP3E23 1SP3E23 1SP3E23	1SP3E2 1SP3E2 1SP3E2	1SP3E0 1SP3E0 2SP3E2	1GP3E0 2SP3E23 2SP3E23
				Evidence	3 3 3	3 3 3	3 3 3	1 1 3	1 3 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 4 4
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
43	3208	12052837_1	Glycosylphosphatidylinositol (GPI)-anchored proteins are synthesized on membrane-bound ribosomes, |A1:**1SP3E3| translocated across the endoplasmic reticulum membrane, and GPI-anchored by GPI transamidase (GPIT). |A1:**2SP3E3| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E3 2SP3E3	1SP3E1 1SP3E1	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0
				Evidence	4 4	2 2	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
44	9502	12707304_268	Nuclear PKP3 could not be detected in contrast to PKP1 and PKP2 ( Mertens et al., 1996; Schmidt et al., 1997). |A1:**1SN3E2| |A2:**1SN3E2| |A3:**1SN3E2| |A4:**1SN3E2| |A5:**1GN3E2|
				Annotation	1SN3E2	1SN3E2	1SN3E2	1SN3E2	1GN3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	1	1	1	1	1
45	2983	11357142_70	Most sporadic colorectal tumours also involve constitutive activation of the Tcf-mediated Wnt transcriptional response, |A5:**1SP2E0+| |A2:**1SP2E1+| |A4:**1SP3E0| due either to loss of APC |A5:**2SP3E0-| or to stabilizing oncogenic mutations in beta-catenin 3, 28. |A5:**3SP3E2| |A1:**1SP3E2-| |A2:**1SP2E2-| |A3:**1SP2E0| |A4:**2SP3E2|
				Annotation	1SP3E2- 1SP3E2- 1SP3E2-	1SP2E1+ 1SP2E2- 1SP2E2-	1SP2E0 1SP2E0 1SP2E0	1SP3E0 2SP3E2 2SP3E2	1SP2E0+ 2SP3E0- 3SP3E2
				Evidence	3 3 3	2 3 3	1 1 1	1 3 3	1 1 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	6 6 6	6 6 6	7 7 7	6 7 7
46	8243	9603979_37	Gal4-RAP46 fusion protein-encoding plasmid was generated by cloning the RAP46 sequence in frame into pSG424 (the Gal4-DBD vector) (23). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1MP3E2| |A4:**1MP3E2| |A5:**1SP3E2|
				Annotation	1SP3E23	1SP3E23	1MP3E2	1MP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	2	2	4
				Polarity	7	7	7	7	7
47	8078	8653784_219	Similar to our results with the Xmads, mRNA injection of some components of the Wnt signal transduction pathway, such as glycogen synthase kinase-3 or dishevelled, leads to activation of the Wnt signal |A1:**1SP3E3+| |A2:**1SP3E3+| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3+|
				Annotation	1SP3E3+	1SP3E3+	1SP3E3	1SP3E3	1SP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
48	6528	9501094_219	Interestingly, the mutation of the DNA-binding sites (Figure 7) and the transactivation domain deletion mutants (Figure 8) |A3:**1MP3E3| |A4:**1MP3E3| have reciprocal effects on enhancer function: |A1:**1SP3E3+| |A2:**1SP3E3| |A5:**1SP3E3| whereas a mutation of the E-box alone almost completely abolishes the activity of the enhancer element, |A1:**2SN3E3-| |A2:**1SN3E3-| |A5:**2SP3E3-| USFdeltaTA has no effect. |A1:**3SN3E3| |A2:**3SN3E3| |A3:**1SN3E0-| |A4:**2SN3E0-| |A5:**3SP3E3|
				Annotation	1SP3E3+ 1SP3E3+ 2SN3E3- 3SN3E3	1SP3E3 1SP3E3 1SN3E3- 3SN3E3	1MP3E3 1SN3E0- 1SN3E0- 1SN3E0-	1MP3E3 2SN3E0- 2SN3E0- 2SN3E0-	1SP3E3 1SP3E3 2SP3E3- 3SP3E3
				Evidence	4 4 4 4	4 4 4 4	4 1 1 1	4 1 1 1	4 4 4 4
				Focus	4 4 4 4	4 4 4 4	2 4 4 4	2 4 4 4	4 4 4 4
				Polarity	7 7 1 1	7 7 1 1	7 1 1 1	7 1 1 1	7 7 7 7
49	1957	11408527_15	Adenosine exerts multiple actions throughout the body and modifies various cardiovascular functions (Berne, 1980). |A1:**1GP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1GP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
50	9832	10490647_749	The Xenopus homeobox gene Twin mediates Wnt induction of Goosecoid in establishment of Spemann's organizer. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0+|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0+
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
51	9464	9665968_166	Further confirmation was obtained with slide agglutination antiserum, which is an option for excluding possible false-positive strains. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1MP3E3| |A5:**1MP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1MP3E3	1MP3E1
				Evidence	4	4	1	4	2
				Focus	4	4	4	2	2
				Polarity	7	7	7	7	7
52	4966	12173058_16	Our results further demonstrate that the faster and simple registration method allows us to use the system more frequently, |A5:**1GP3E3| thereby increasing the number of navigated cases. |A5:**2GP3E1+| |A1:**1GP3E3+| |A2:**1GP3E3+| |A3:**1GP2E3| |A4:**1SP3E3+|
				Annotation	1GP3E3+ 1GP3E3+	1GP3E3+ 1GP3E3+	1GP2E3 1GP2E3	1SP3E3+ 1SP3E3+	1GP3E3 2GP3E1+
				Evidence	4 4	4 4	4 4	4 4	4 2
				Focus	1 1	1 1	1 1	4 4	1 1
				Polarity	7 7	7 7	6 6	7 7	7 7
53	5759	9632612_169	We previously reported that the NCHi-PRT 1 isolate in question had the same P2 sequence as an NCHi-PRT 25 isolate; |A3:**1SP3E1| |A4:**1SP3E3| |A5:**1SP3E13| this was most likely a result of horizontal gene transfer (31). |A3:**2SP2E2| |A1:**1SP3E23| |A2:**1SP3E23| |A4:**2SP3E2| |A5:**2SP3E2|
				Annotation	1SP3E23 1SP3E23	1SP3E23 1SP3E23	1SP3E1 2SP2E2	1SP3E3 2SP3E2	1SP3E13 2SP3E2
				Evidence	3 3	3 3	2 3	4 3	2 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 6	7 7	7 7
54	784	10747890_60	Termination probability was calculated as outlined under "Experimental Procedures." |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E3	1GP3E3	1GP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
55	3665	9419341_90	After pelleting, beads were washed in extract buffer, and the pellets and supernatant were analyzed by SDS-PAGE and Western blotting with anti-histone H3 antibody. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
56	2529	10567588_236	Ubiquitination of the ankyrin repeats of p105 is also observed |A4:**1SP3E3| and may be required for proteolytic processing of this protein (58, 60, 61). |A4:**2SP3E2| |A1:**1SP1E2| |A2:**1SP1E2| |A3:**1SP2E2| |A5:**1SP2E2-|
				Annotation	1SP1E2 1SP1E2	1SP1E2 1SP1E2	1SP2E2 1SP2E2	1SP3E3 2SP3E2	1SP2E2- 1SP2E2-
				Evidence	3 3	3 3	3 3	4 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	5 5	6 6	7 7	6 6
57	6443	9721280_142	Fluorescent bands corresponding to Chit108 and Chit67 appeared as a result of the release of 4 MU 4-MU from trimeric [4 MU (GlcNAc)2 [4-MU-(GlcNAc)2 and tetrameric [4 MU (GlcNAc)3 [4-MU-(GlcNAc)3 chitin analogs, |A1:**1SP3E0| |A2:**1MP3E3| |A3:**1MSP3E3| |A4:**1MP3E3| |A5:**1SP3E3+| but not from the dimeric analog 4 MU GlcNAc. 4-MU-GlcNAc. |A1:**2SN3E0| |A2:**1MN3E3| |A3:**2SN3E3| |A4:**2MN3E0| |A5:**2GN3E0|
				Annotation	1SP3E0 2SN3E0	1MP3E3 1MN3E3	1MSP3E3 2SN3E3	1MP3E3 2MN3E0	1SP3E3+ 2GN3E0
				Evidence	1 1	4 4	4 4	4 1	4 1
				Focus	4 4	2 2	6 4	2 2	4 1
				Polarity	7 1	7 1	7 1	7 1	7 1
58	9044	11961915_6	The process of experiential avoidance mediated the bivariate correlation between anxiety sensitivity and coping-motivated drinking to a greater extent than did the process of alexithymic coping. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1GP3E3| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP3E0	1GP3E3	1SP3E3	1GP3E0
				Evidence	1	1	4	4	1
				Focus	1	1	1	4	1
				Polarity	7	7	7	7	7
59	528	11906793_4	GDNF immunoreactivity was localized to RGCs, photoreceptors, and retinal pigment epithelial cells. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1MP3E3	1GP3E1
				Evidence	4	4	4	4	2
				Focus	4	4	4	2	1
				Polarity	7	7	7	7	7
60	262	10749878_244	Furthermore, both calphostin C and the dominant negative PKC inhibit partially the Wnt-mediated Tcf/ef reporter activation. |A1:**1SN3E3-| |A2:**1SN3E1-| |A3:**1SP3E0| |A4:**1SN2E0-| |A5:**1SP3E1-|
				Annotation	1SN3E3-	1SN3E1-	1SP3E0	1SN2E0-	1SP3E1-
				Evidence	4	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	1	1	7	2	7
61	1255	12569130_289	Either these molecules have different signaling activities or some mechanism may be required to prevent Wnt signaling outside the AER (see below). |A1:**1GP1E3| |A2:**1SP1E1| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP1E3|
				Annotation	1GP1E3	1SP1E1	1SP2E3	1SP2E3	1GP1E3
				Evidence	4	2	4	4	4
				Focus	1	4	4	4	1
				Polarity	5	5	6	6	5
62	4981	9802909_436	Our data support the view that there are at least three distinct GDI isoforms (Janoueix-Lerosey et al., 1995; Pfeffer et al., 1995). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E23|
				Annotation	1SP3E23	1SP3E23	1SP3E2	1SP3E2	1GP3E23
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
63	9760	11279051_1	The cornified envelope (CE) has a vital role in the barrier function of stratified squamous epithelia. |A1:**1GP3E1| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SN3E0| |A5:**1SP3E0|
				Annotation	1GP3E1	1SP3E0	1SP3E0	1SN3E0	1SP3E0
				Evidence	2	1	1	1	1
				Focus	1	4	4	4	4
				Polarity	7	7	7	1	7
64	5896	9700168_45	Full-length cDNAs coding for chicken cRac1A, cRac1B, cRhoA, and cRhoB polypeptides were obtained by PCR from the corresponding clones in pBluescript KS vector (Malosio et al., 1997), |A4:**1MP3E2| |A5:**1SP3E2| and subcloned into the pGEX-4T-1 vector (Pharmacia Biotech, Uppsala, Sweden). |A4:**2MP3E0| |A1:**1MP3E23| |A2:**1MP3E23| |A3:**1MSP3E3| |A5:**2SP3E3|
				Annotation	1MP3E23 1MP3E23	1MP3E23 1MP3E23	1MSP3E3 1MSP3E3	1MP3E2 2MP3E0	1SP3E2 2SP3E3
				Evidence	3 3	3 3	4 4	3 1	3 4
				Focus	2 2	2 2	6 6	2 2	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
65	3293	10319820_357	Such animals derived from a delII germ cell. |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1GP3E0| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E0	1SP3E0	1GP3E0	1GP3E1
				Evidence	4	1	1	1	2
				Focus	4	4	4	1	1
				Polarity	7	7	7	7	7
66	1382	11889220_1	The melanocortin 3 receptor (MC3R) plays a critical role in weight regulation as demonstrated in mouse models. |A1:**1GP3E3| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E1|
				Annotation	1GP3E3	1SP3E1	1SP3E3	1SP3E3	1SP3E1
				Evidence	4	2	4	4	2
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
67	2929	11585828_20	These observations, when considered together, are consistent with B56alpha binding to the APC ARM domain and carrying APC into the nucleus. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**1SP2E1|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E3	1SP2E1
				Evidence	4	4	1	4	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	6
68	7764	11083814_29	These findings suggest that neutrophil-derived cytokines and chemokines might represent an early event during the course of meningitis. |A1:**1SP1E3| |A2:**1SP2E3| |A3:**1SP2E0| |A4:**1SP2E1| |A5:**1SP1E1|
				Annotation	1SP1E3	1SP2E3	1SP2E0	1SP2E1	1SP1E1
				Evidence	4	4	1	2	2
				Focus	4	4	4	4	4
				Polarity	5	6	6	6	5
69	3556	10618246_208	In our study we performed correspondence analyses, which took into account both the presence of a band and its relative staining intensity. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1MSP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1MP3E3	1SP3E3	1MSP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	2	4	6	4	1
				Polarity	7	7	7	7	7
70	8105	11916423_1	Semiclassical molecular dynamics simulations have been combined with quantum chemistry calculations |A5:**1MP3E1| to provide detailed modeling of the methane and ethane hydroxylation reactions catalyzed by the hydroxylase enzymes of the soluble methane monooxygenase system. |A5:**2GP3E0| |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1SP3E0| |A4:**1MP3E3|
				Annotation	1GP3E0 1GP3E0	1GP3E0 1GP3E0	1SP3E0 1SP3E0	1MP3E3 1MP3E3	1MP3E1 2GP3E0
				Evidence	1 1	1 1	1 1	4 4	2 1
				Focus	1 1	1 1	4 4	2 2	2 1
				Polarity	7 7	7 7	7 7	7 7	7 7
71	1068	12069952_5	In primate fat cells, NP-induced lipolysis involved a cGMP-dependent pathway. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
72	7723	9548972_97	At each downward step in stringency, the increase in sensitivity is primarily the result of inclusion of new ESTs. |A1:**1GP3E0+| |A2:**1GP3E0+| |A3:**1SP3E0+| |A4:**1SP3E3+| |A5:**1GP3E0|
				Annotation	1GP3E0+	1GP3E0+	1SP3E0+	1SP3E3+	1GP3E0
				Evidence	1	1	1	4	1
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
73	6488	11149951_26	Several studies have demonstrated the increased binding of dopamine antagonists in lymphocytes of schizophrenic patients as compared with healthy individuals (11, 12). |A1:**1SP3E2+| |A2:**1SP3E2+| |A3:**1SP3E2| |A4:**1SP3E2+| |A5:**1SP3E2+|
				Annotation	1SP3E2+	1SP3E2+	1SP3E2	1SP3E2+	1SP3E2+
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
74	5290	9827803_244	Nearly all tissues and organs can develop normally or near normally in the complete absence of the entire family of v integrins, comprising five different adhesion receptors with a multiplicity of ECM ligands. |A1:**1GP2E0| |A2:**1SP1E0| |A3:**1SP1E0| |A4:**1SP2E3| |A5:**1GP3E0|
				Annotation	1GP2E0	1SP1E0	1SP1E0	1SP2E3	1GP3E0
				Evidence	1	1	1	4	1
				Focus	1	4	4	4	1
				Polarity	6	5	5	6	7
75	4468	7814421_42	In other tumor types, such as renal cell carcinoma, significant fibrin was observed in tumor stroma despite the absence of demonstrable tissue factor antigen on these tumor cells ( ). |A1:**1GP3E23| |A2:**1SP3E2| |A3:**1SP1E3| |A4:**1SP2E3| |A5:**1SP2E2|
				Annotation	1GP3E23	1SP3E2	1SP1E3	1SP2E3	1SP2E2
				Evidence	3	3	4	4	3
				Focus	1	4	4	4	4
				Polarity	7	7	5	6	6
76	8205	10421629_4	Wnt signaling stabilizes beta-catenin, |A3:**1SP3E0| |A5:**1GP3EO| but it was not clear whether and how Wnt signaling regulates the beta-catenin complex. |A3:**2SN0E0| |A1:**1SP0E3| |A2:**1SN0E0| |A4:**1SN2E0| |A5:**2SN0E0|
				Annotation	1SP0E3 1SP0E3	1SN0E0 1SN0E0	1SP3E0 2SN0E0	1SN2E0 1SN2E0	2SN0E0 2SN0E0
				Evidence	4 4	1 1	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	4 4	4 4	7 4	2 2	4 4
77	593	9797283_40	The clinical strains Enterobacter cloacae RYC70770 and Escherichia hermannii RYC78330 were provided by the Hospital Ramon y Cajal, Madrid, Spain. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1SP3E3	1GP3E0
				Evidence	4	4	4	4	1
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
78	3048	12702652_170	As a result, Sfrps can be used to inhibit a broad range of Wnt signals, |A4:**1SP3E3| including Wnt7a (Hall et al., 2000 ; Yoshino et al., 2001 ; Bergwitz et al., 2001 ). |A1:**1SN3E2| |A2:**1SP3E2-| |A3:**1SP2E2-| |A4:**2SP3E2| |A5:**1SP3E2|
				Annotation	1SN3E2 1SN3E2	1SP3E2- 1SP3E2-	1SP2E2- 1SP2E2-	1SP3E3 2SP3E2	1SP3E2 1SP3E2
				Evidence	3 3	3 3	3 3	4 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	7 7	6 6	7 7	7 7
79	2485	9777950_1	Occult aspects of tumor proliferation are likely recorded genetically as their microsatellite (MS) loci become polymorphic. |A1:**1GP3E1| |A2:**1SP1E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP2E0|
				Annotation	1GP3E1	1SP1E0	1SP2E0	1SP2E0	1GP2E0
				Evidence	2	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	7	5	6	6	6
80	5690	11867725_20	Sulcal/gyral anatomy shows marked variation between individuals |A4:**1SP2E3| and is dissimilar even within pairs of healthy identical or monozygotic (MZ) co-twins (20, 21). |A4:**2SP3E2| |A1:**1GP3E2| |A2:**1SN3E23| |A3:**1SP3E2| |A5:**1GP3E2|
				Annotation	1GP3E2 1GP3E2	1SN3E23 1SN3E23	1SP3E2 1SP3E2	1SP2E3 2SP3E2	1GP3E2 1GP3E2
				Evidence	3 3	3 3	3 3	4 3	3 3
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	7 7	1 1	7 7	6 7	7 7
81	4013	11133465_64	One unit of the PLA-degrading activity was defined as a 1-U decrease in absorbance at 630 nm per min under the assay conditions described. |A1:**1SP3E3-| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E1-|
				Annotation	1SP3E3-	1SP3E3	1SP3E3	1SP3E3	1MP3E1-
				Evidence	4	4	4	4	2
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
82	2229	10380924_217	We have shown that rather than binding stably with POP-1, WRM-1 is required for POP-1 phosphorylation. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
83	3232	9844016_10	In the dorsolateral prefrontal cortex, functional hypoactivity (3) in schizophrenia is associated with defects in a number of neurotransmitter systems ( 4-11), |A4:**1SP3E2| including the inhibitory gamma-amino butyrate (GABA)ergic system. |A4:**2SP3E0| |A1:**1GP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A5:**1GP3E2|
				Annotation	1GP3E2 1GP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 2SP3E0	1GP3E2 1GP3E2
				Evidence	3 3	3 3	3 3	3 1	3 3
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
84	6292	12651889_284	Wnt signaling polarizes an early C. elegans blastomere to distinguish endoderm and mesoderm. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
85	9395	9508000_76	Alternatively, proteins were electroblotted onto nitrocellulose for immunoblot analysis with IgG-C7 and IgG-HL1 or 45Ca blot analysis. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
86	678	12079534_1	PURPOSE: To characterize the role of various cellular damagesensing, processing and survival genes in the in-vitro radiosensitivity of haemopoietic colony-forming cells. |A1:**1GP2E0| |A2:**1SP2E0| |A3:**1SP3E0| |A4:**1MP3E3| |A5:**1GP0E0|
				Annotation	1GP2E0	1SP2E0	1SP3E0	1MP3E3	1GP0E0
				Evidence	1	1	1	4	1
				Focus	1	4	4	2	1
				Polarity	6	6	7	7	4
87	5294	9464989_145	We have examined the structure of the paranode and the node of Ranvier in mice incapable of synthesizing the myelin galactolipids GalC and sulfatide. |A1:**1GN3E1| |A2:**1SN3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1GN3E1	1SN3E1	1SP3E3	1SP3E3	1GP3E3
				Evidence	2	2	4	4	4
				Focus	1	4	4	4	1
				Polarity	1	1	7	7	7
88	278	11976332_58	All these peptides were found to serve as substrates, their K m values ranging from 10 to 40 muM (Table III). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
89	2041	9230313_36	Thus, analysis of the Fu locus has identified a novel inhibitor of the Wnt signaling pathway |A1:**1SN3E1| |A2:**1SN3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E1| and suggests that the same pathway regulates an early step in embryonic axis formation in mammals and amphibians. |A1:**2SP3E1| |A2:**2SP3E1| |A3:**2SP2E0| |A4:**2SP3E1| |A5:**2GP2E0|
				Annotation	1SN3E1 2SP3E1	1SN3E1 2SP3E1	1SP3E3 2SP2E0	1SP3E3 2SP3E1	1GP3E1 2GP2E0
				Evidence	2 2	2 2	4 1	4 2	2 1
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	1 7	1 7	7 6	7 7	7 6
90	9828	11679314_117	The methyl ester in the organic layer was analyzed by using GC. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E3| |A5:**1GP3E1|
				Annotation	1MP3E3	1SP3E3	1MP3E3	1SP3E3	1GP3E1
				Evidence	4	4	4	4	2
				Focus	2	4	2	4	1
				Polarity	7	7	7	7	7
91	6672	10801471_232	In general, anti idiotype anti-idiotype RNA aptamers isolated with an anti ligand anti-ligand antibody |A4:**1SP3E0| can apparently mimic faithfully some of the structural and functional properties of a protein domain in vivo and in vitro [23,30,34]. |A4:**2MP2E2| |A1:**1GP2E2| |A2:**1SP2E2| |A3:**1MSP3E2| |A5:**1SP3E2|
				Annotation	1GP2E2 1GP2E2	1SP2E2 1SP2E2	1MSP3E2 1MSP3E2	1SP3E0 2MP2E2	1SP3E2 1SP3E2
				Evidence	3 3	3 3	3 3	1 3	3 3
				Focus	1 1	4 4	6 6	4 2	4 4
				Polarity	6 6	6 6	7 7	7 6	7 7
92	9825	11333250_111	No significant homology to GenBank sequences was observed for the first 1.5 kb. |A1:**1SN3E3| |A2:**1SN3E3| |A3:**1SN3E3| |A4:**1GN2E0| |A5:**1GN3E1|
				Annotation	1SN3E3	1SN3E3	1SN3E3	1GN2E0	1GN3E1
				Evidence	4	4	4	1	2
				Focus	4	4	4	1	1
				Polarity	1	1	1	2	1
93	9094	11349131_16	The interaction-trap assay was performed as described previously ( ). |A1:**1MP3E2| |A2:**1MP3E2| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1GMP3E2| Numbers in parentheses are the amino acid residues of p45SKP2 ( A) or CDK2 ( B) fused to the LexA DNA-binding domain. |A1:**2SP3E3| |A2:**2SP3E3| |A3:**1SP3E0| |A4:**2SP3E0| |A5:**2GP3E0|
				Annotation	1MP3E2 2SP3E3	1MP3E2 2SP3E3	1MP3E3 1SP3E0	1MP3E3 2SP3E0	1GMP3E2 2GP3E0
				Evidence	3 4	3 4	4 1	4 1	3 1
				Focus	2 4	2 4	2 4	2 4	3 1
				Polarity	7 7	7 7	7 7	7 7	7 7
94	3139	10496918_96	Among pregnant women, primiparae with noninfected placentas have the higher likelihood not to have been infected with placental parasites. |A1:**1GP1E1| |A2:**1SP2E0| |A3:**1SN2E0| |A4:**1SN2E3+| |A5:**1GN2E0|
				Annotation	1GP1E1	1SP2E0	1SN2E0	1SN2E3+	1GN2E0
				Evidence	2	1	1	4	1
				Focus	1	4	4	4	1
				Polarity	5	6	2	2	2
95	8093	11533249_31	A genomic DNA fragment of the murine stat3 gene was isolated from a lambda fix II 129/sv mouse genomic library (Stratagene) |A3:**1SP3E3| |A4:**1SP3E3| using a 2.2-kb genomic fragment of the stat3 promoter as a probe (16). |A3:**1SP3E2| |A1:**1SP3E23| |A2:**1SP3E23| |A4:**2SP3E2| |A5:**1MP3E2|
				Annotation	1SP3E23 1SP3E23	1SP3E23 1SP3E23	1SP3E3 1SP3E2	1SP3E3 2SP3E2	1MP3E2 1MP3E2
				Evidence	3 3	3 3	4 3	4 3	3 3
				Focus	4 4	4 4	4 4	4 4	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
96	6419	10893270_256	Wnt proteins increased beta catenin beta-catenin levels in cardiac myocytes and fibroblasts. |A1:**1SP3E3+| |A2:**1SP3E0+| |A3:**1SP3E0+| |A4:**1SP3E0+| |A5:**1GP3E1+|
				Annotation	1SP3E3+	1SP3E0+	1SP3E0+	1SP3E0+	1GP3E1+
				Evidence	4	1	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
97	9253	9107167_6	Lymphocyte activation was studied at day 1 of hospital admission and after 7, 15, 30, 60, and 90 days. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3+| |A4:**1SP3E3| |A5:**1MP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E3+	1SP3E3	1MP3E1
				Evidence	4	4	4	4	2
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
98	6308	12361574_5	The relative position of the chromosomes involved in these translocations is conserved in normal splenocytes. |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP2E0| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E0	1SP3E0	1SP2E0	1GP3E1
				Evidence	4	1	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	6	7
99	4508	9547360_141	Before proceeding with a detailed examination of the PMA effect, |A5:**1GP3E0| it was necessary to confirm that the effect was not a clonal artifact unique to the P5A11 cell line. |A5:**2GN1E0| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SN2E0| |A4:**1SN3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SN2E0 1SN2E0	1SN3E3 1SN3E3	1GP3E0 2GN1E0
				Evidence	4 4	4 4	1 1	4 4	1 1
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	2 2	1 1	7 3
100	79	9407023_209	The genetic evidence that Wnt proteins require Fz proteins for signaling, |A5:**1GP3E1| although lacking in flies, |A5:**2GP3E1-| is accumulating in C. elegans (Table 3), |A5:**3GP3E3+| |A3:**1SPE2| |A4:**1SP3E3| though the story is a little complicated. |A5:**4GP1E0| |A1:**1SP2E3| |A2:**1SP2E3| |A3:**1GP0E0| |A4:**2GP3E0|
				Annotation	1SP2E3 1SP2E3 1SP2E3 1SP2E3	1SP2E3 1SP2E3 1SP2E3 1SP2E3	1GP0E0 1GP0E0 1GP0E0 1GP0E0	1SP3E3 1SP3E3 1SP3E3 2GP3E0	1GP3E1 2GP3E1- 3GP3E3+ 4GP1E0
				Evidence	4 4 4 4	4 4 4 4	1 1 1 1	4 4 4 1	2 2 4 1
				Focus	4 4 4 4	4 4 4 4	1 1 1 1	4 4 4 1	1 1 1 1
				Polarity	6 6 6 6	6 6 6 6	4 4 4 4	7 7 7 7	7 7 7 5
101	4024	9502810_68	The lesion was defined as the area that included axons that were completely and partially demyelinated |A4:**1SP3E0| |A5:**1GP3E3-| as well as completely and partially remyelinated (Fig. 1). |A4:**2SP3E3| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A5:**2GP3E3+|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP2E3 1SP2E3	1SP3E0 2SP3E3	1GP3E3- 2GP3E3+
				Evidence	4 4	4 4	4 4	1 4	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	6 6	7 7	7 7
102	7073	11136978_12	Class I enzymes are acutely activated by a variety of cell-surface receptors, |A1:**1SP3E3+| |A2:**1SP3E3+| and are responsible for synthesis of intracellular phosphatidylinositol (3, 4, 5)-trisphosphate (PtdIns (3, 4, 5) P3). |A1:**2SP3E3| |A2:**2SP3E3| |A3:**1SP2E0+| |A4:**1SP3E3| |A5:**1SP3E0|
				Annotation	1SP3E3+ 2SP3E3	1SP3E3+ 2SP3E3	1SP2E0+ 1SP2E0+	1SP3E3 1SP3E3	1SP3E0 1SP3E0
				Evidence	4 4	4 4	1 1	4 4	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	6 6	7 7	7 7
103	6613	11679341_106	If one assumes that viral OB in only the top 0.2 cm of soil are subject to possible transport by precipitation, |A5:**1GP1E0| then the proportion of OB transported to foliage of cotton plants still ranged only from 6.2 x 10 6 to 2.5 x 10 5. |A5:**2GP3E3| |A1:**1GP1E0| |A2:**1SP1E0| |A3:**1SP2E0| |A4:**1SP2E0|
				Annotation	1GP1E0 1GP1E0	1SP1E0 1SP1E0	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1GP1E0 2GP3E3
				Evidence	1 1	1 1	1 1	1 1	1 4
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	5 5	5 5	6 6	6 6	5 7
104	8268	10330411_361	These motifs are implicated in the binding of paxillin to vinculin, FAK, and the E6 oncoprotein from papillomavirus (Brown et al., 1996; Tong et al., 1997 ; Vande Pol et al., 1998). |A3:**1SP3E2| |A1:**1SP3E2| |A2:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
105	4504	12185709_1	Current views on efficacy and safety of magnesium sulfate treatment in obstetrics are presented. |A1:**1GP3E3| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1GP3E0| |A5:**1GP3E3|
				Annotation	1GP3E3	1SP3E1	1SP3E3	1GP3E0	1GP3E3
				Evidence	4	2	4	1	4
				Focus	1	4	4	1	1
				Polarity	7	7	7	7	7
106	9155	11555643_1	GROs are a new type of antiproliferative oligonucleotide with considerable potential as therapeutic agents for cancer. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP2E0| |A4:**1SP3E0| |A5:**1GP2E0|
				Annotation	1GP3E0	1SP3E0	1SP2E0	1SP3E0	1GP2E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	7	7	6	7	6
107	5888	11279203_93	Analysis of these data revealed three major differences in the translocation profiles (Fig. 8 B). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1GP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	1	1
				Polarity	7	7	7	7	7
108	9847	10026183_146	Thus, increases of nuclear cytochrome c-GFP reflected increases of cytosolic cytochrome c-GFP. |A1:**1SP3E3+| |A2:**1SP3E1+| |A3:**1SP2E0| |A4:**1SP3E0+| |A5:**1SP3E1+|
				Annotation	1SP3E3+	1SP3E1+	1SP2E0	1SP3E0+	1SP3E1+
				Evidence	4	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	6	7	7
109	4884	10985388_13	Thus, MEI-S332 function is necessary for normal minichromosome transmission. |A1:**1GP3E3| |A2:**1GP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E3	1GP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	4	1	1	1	1
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
110	1601	9472043_229	Received for publication 22 August 1997 and in revised form 16 November 1997. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E0| |A4:**1GP3E3| |A5:**1GP3E0|
				Annotation	1GP3E3	1GP3E3	1GP3E0	1GP3E3	1GP3E0
				Evidence	4	4	1	4	1
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
111	3358	9351973_90	This large shift on incubation with AP was inhibited by the presence of NaF (Fig. 1A). |A1:**1SN3E3| |A2:**1SP3E3-| |A3:**1SP3E3-| |A4:**1SN3E3| |A5:**1GP3E3-|
				Annotation	1SN3E3	1SP3E3-	1SP3E3-	1SN3E3	1GP3E3-
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	1	7	7	1	7
112	4472	12116612_2	This internationally best selling book, written for lay readers, described several recorded sessions of alleged time-regression to a prior life nearly two centuries before 1956. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E1|
				Annotation	1GP3E3	1GP3E3	1GP3E3	1GP3E3	1GP3E1
				Evidence	4	4	4	4	2
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
113	9658	12530981_184	Precipitates were resolved by SDS-PAGE |A1:**1MP3E3| and proteins were visualized by autoradiography. |A1:**2MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 2MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	2 2	4 4	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
114	3563	11416148_141	To achieve levels of apoptosis which were comparable to the death seen in HOMyc3 cells, |A5:**1SP3E1| we assayed for apoptosis in HO15.19 cells over an extended time course. |A5:**2SP3E3| |A1:**1MSP2E3| |A2:**1MP3E1| |A3:**1MP3E3| |A4:**1MP3E3|
				Annotation	1MSP2E3 1MSP2E3	1MP3E1 1MP3E1	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1SP3E1 2SP3E3
				Evidence	4 4	2 2	4 4	4 4	2 4
				Focus	6 6	2 2	2 2	2 2	4 4
				Polarity	6 6	7 7	7 7	7 7	7 7
115	3499	9312148_21	The function of this gene, necessary for surfactin production, |A5:**1GP3E1| is still unclear. |A5:**2GP0E0| |A1:**1GP0E0| |A2:**1SN0E0| |A3:**1SP0E0| |A4:**1SP0E0|
				Annotation	1GP0E0 1GP0E0	1SN0E0 1SN0E0	1SP0E0 1SP0E0	1SP0E0 1SP0E0	1GP3E1 2GP0E0
				Evidence	1 1	1 1	1 1	1 1	2 1
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	4 4	4 4	4 4	4 4	7 4
116	2688	11139192_96	Restriction enzyme ( EcoRI) digests of the phage DNA were subjected to gel electrophoresis on a 0.8% agarose gel at 40 V for 3 h. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
117	2796	9727068_235	p21 mRNA induction occurred earlier and was more sustained in C/ EBPbeta / livers at several time points posthepatectomy (Fig. 7 A). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1SP3E3+|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1MP3E3	1SP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	2	4
				Polarity	7	7	7	7	7
118	4447	12479820_317	A tumor fragment inoculum or 5 x 106 of the corresponding cancer cell suspension was pelleted by centrifugation. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	4	2
				Polarity	7	7	7	7	7
119	2946	9463377_336	Plasmids pEG1-KK and pEG1-QK, encoding Inv.-Wbp1p fusion proteins with, or without, a functional retrieval motif were used (Gaynor et al., 1994). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP1E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E23	1SP3E23	1SP1E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	5	7	7
120	5985	11207362_384	To prepare osteoclasts from progenitor cells, spleen cells from 4-week-old mice were cocultured for 14 days on biotinylated ivory with ST2 stromal cells in the presence of 10 nM vitamin D3 and 100 nM dexamethasone (Udagawa et al., 1989). |A1:**1SP2E23| |A2:**1MP3E23| |A3:**1MSP3E2| |A4:**1SP3E2| |A5:**1MP3E23|
				Annotation	1SP2E23	1MP3E23	1MSP3E2	1SP3E2	1MP3E23
				Evidence	3	3	3	3	3
				Focus	4	2	6	4	2
				Polarity	6	7	7	7	7
121	6838	11014836_6	Our analysis suggests genetic variance for Drosophila mortality declines with age, |A2:**1SP3E3-| |A5:**1SP1E3-| while genetic variance is constant at all ages for reproductive output. |A2:**1SP3E3| |A1:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**2SP2E3|
				Annotation	1GP3E3 1GP3E3	1SP3E3- 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP1E3- 2SP2E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	1 1	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	5 6
122	4786	12575957_106	Thus, our results confirm that the currents underlying action potential generation can largely account for the results described above and in Figure 2. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	4	4
				Polarity	7	7	7	7	7
123	1471	11571181_1	The diversity of French fungus-ripened cheeses |A5:**1GP3E0| is due partly to the succession of fungi that colonize the cheese during ripening. |A5:**1GP2E0+| |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1SP1E0| |A4:**1GP2E0|
				Annotation	1GP3E0 1GP3E0	1GP3E0 1GP3E0	1SP1E0 1SP1E0	1GP2E0 1GP2E0	1GP3E0 1GP2E0+
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	1 1	1 1	4 4	1 1	1 1
				Polarity	7 7	7 7	5 5	6 6	7 6
124	7519	10391866_56	These were analyzed by approved strategies by EIA and Western blot analysis (Cambridge Biotech Corp., Worcester, Mass.). |A1:**1MP1E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E1|
				Annotation	1MP1E3	1SP3E3	1MP3E3	1MP3E3	1MP3E1
				Evidence	4	4	4	4	2
				Focus	2	4	2	2	2
				Polarity	5	7	7	7	7
125	8527	9788248_165	After a 2-h chase at 37 degrees C, the quantity of intracellular PLTP was clearly reduced. |A1:**1SP3E3-| |A2:**1SP3E3-| |A3:**1MP3E3-| |A4:**1SP3E3| |A5:**1MP3E3-|
				Annotation	1SP3E3-	1SP3E3-	1MP3E3-	1SP3E3	1MP3E3-
				Evidence	4	4	4	4	4
				Focus	4	4	2	4	2
				Polarity	7	7	7	7	7
126	748	11381111_9	These data suggest that the COMT Val allele, |A5:**1GP2E1| because it increases prefrontal dopamine catabolism, |A2:**1SP3E3+| |A1:**1SP3E3+| |A3:**1SP3E3+| |A4:**1SP3E3+| |A5:**2SP3E0+| impairs prefrontal cognition and physiology, |A2:**2SP3E3| |A1:**2SN3E3| |A3:**2SP3E0| |A4:**2SP3E0| |A5:**3SP3E0-| and by this mechanism slightly increases risk for schizophrenia. |A2:**3SP3E3+| |A1:**3SP3E3+| |A3:**3SP2E3+| |A4:**3SP2E3+| |A5:**4GP3E0+|
				Annotation	1SP3E3+ 1SP3E3+ 2SN3E3 3SP3E3+	1SP3E3+ 1SP3E3+ 2SP3E3 3SP3E3+	1SP3E3+ 1SP3E3+ 2SP3E0 3SP2E3+	1SP3E3+ 1SP3E3+ 2SP3E0 3SP2E3+	1GP2E1 2SP3E0+ 3SP3E0- 4GP3E0+
				Evidence	4 4 4 4	4 4 4 4	4 4 1 4	4 4 1 4	2 1 1 1
				Focus	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4	1 4 4 1
				Polarity	7 7 1 7	7 7 7 7	7 7 7 6	7 7 7 6	6 7 7 7
127	380	12408808_140	(C) In wild-type muscle-tendon cell junctions, actin filaments terminate at the submembranous density of the muscle hemiadherens junctions (arrowhead), |A1:**1SN3E0| |A2:**1SN3E0| while, in the tendon cells, microtubules (arrow) run from tonofibrils embedded in the cuticle (c) to the basal hemiadherens junctions. |A1:**2SP3E0| |A2:**2SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E3|
				Annotation	1SN3E0 2SP3E0	1SN3E0 2SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E3 1SP3E3
				Evidence	1 1	1 1	1 1	1 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 7	1 7	7 7	7 7	7 7
128	2940	9971740_43	For experiments on axons in the presence and absence of metabolic substrates, the above medium was rinsed and replaced with Dulbecco's PBS ( ) supplemented with 0.5% MethocelTM and 50 ng/ml 2.5 nerve growth factor, with or without 0.6% glucose ( ) and 0.055% sodium pyruvate ( ). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E23	1SP3E23	1MP3E3	1MP3E3	1MP3E3
				Evidence	3	3	4	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
129	315	11333250_583	TRAUT, T. W., 1994 The functions and consensus motifs of nine types of peptide segments that form different types of nucleotide-binding sites. |A1:**1SP2E3| |A2:**1SP2E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP2E3	1SP2E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	4	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	6	6	7	7	7
130	3116	10862619_43	In S. pombe, deletion of rqh1 only partially suppressed the defect observed in top3 cells ( ). |A1:**1SN3E2-| |A2:**1SN3E2-| |A3:**1SN1E0| |A4:**1SN2E0| |A5:**1SP3E2-|
				Annotation	1SN3E2-	1SN3E2-	1SN1E0	1SN2E0	1SP3E2-
				Evidence	3	3	1	1	3
				Focus	4	4	4	4	4
				Polarity	1	1	3	2	7
131	5920	10531359_36	The results are expressed as the mean plus-or-minus S.E. of three independent experiments performed in triplicate. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1GP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	1	1
				Polarity	7	7	7	7	7
132	7338	9367983_275	The amplified product was inserted into plasmid II digested with SacI and HindIII. |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1MP3E3	1MP3E3	1MP3E0	1GP3E3
				Evidence	4	4	4	1	4
				Focus	4	2	2	2	1
				Polarity	7	7	7	7	7
133	3254	12111470_7	In Experiment 2, one of the de-novo patients was normosmic, 3 hyposmic, and 1 anosmic. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1MP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	2	1
				Polarity	7	7	7	7	7
134	963	11292744_99	They were submitted from different areas of the United States. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E3| |A4:**1GP3E0| |A5:**1GP3E1|
				Annotation	1GP3E3	1GP3E3	1GP3E3	1GP3E0	1GP3E1
				Evidence	4	4	4	1	2
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
135	4424	10496918_128	Indeed, exogenous CSA almost totally inhibited this binding, |A1:**1SN3E3| |A2:**1SP3E3-| |A3:**1SP2E0| |A4:**1SN3E0-| |A5:**1SP3E3-| while anti-ICAM-1 monoclonal antibody did not affect cytoadherence. |A1:**2SN3E3| |A2:**2SN3E3| |A3:**2SN3E0| |A4:**2SN3E0| |A5:**2SN3E1|
				Annotation	1SN3E3 2SN3E3	1SP3E3- 2SN3E3	1SP2E0 2SN3E0	1SN3E0- 2SN3E0	1SP3E3- 2SN3E1
				Evidence	4 4	4 4	1 1	1 1	4 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	7 1	6 1	1 1	7 1
136	7403	11514458_115	Effect of mating system on polymorphism: |A3:**1SP3E0| |A5:**1GP3E0| The effect of mating system and species on silent polymorphism is highly significant (Mann-Whitney U test, P < 0.001). |A3:**1SP3E2| |A1:**1GP3E3| |A2:**1SP3E3| |A4:**1SP3E0| |A5:**2GP3E3|
				Annotation	1GP3E3 1GP3E3	1SP3E3 1SP3E3	1SP3E0 1SP3E2	1SP3E0 1SP3E0	1GP3E0 2GP3E3
				Evidence	4 4	4 4	1 3	1 1	1 4
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
137	5765	8702751_29	Fig. 3. Fig.3. BoNT E preferentially destabilizes docking protein complexes following ATP-dependent priming. |A1:**1SP3E3| |A2:**1SP3E3-| |A3:**1SP2E3| |A4:**1SP3E3| |A5:**1SP3E3-|
				Annotation	1SP3E3	1SP3E3-	1SP2E3	1SP3E3	1SP3E3-
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	6	7	7
138	2216	10455125_26	In separate experiments, it was however noted that in the presence of Mn2+-activated integrins the contribution of L1-L1 binding of B16F10 cells was marginal (data not shown; also see Fig. |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1MP3E3+| |A5:**1SP3E3|
				Annotation	1SP3E1	1SP3E1	1SP3E3	1MP3E3+	1SP3E3
				Evidence	2	2	4	4	4
				Focus	4	4	4	2	4
				Polarity	7	7	7	7	7
139	3944	9658196_62	The H1 receptor antagonists were dissolved in dimethylsulfoxide at concentrations between 5 and 50 mM, and stock solutions were kept at 20 degrees. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
140	8442	12117676_11	Moreover, a synergistic induction of these MMPs was seen when IL17 was combined with other proinflammatory cytokines. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1SP2E1+|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E0	1SP2E1+
				Evidence	4	4	4	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	6
141	4305	10318810_2	Inhibitors of the peptidyltransferase reaction ( e.g. anisomycin) can trigger a ribotoxic stress response |A3:**1SP2E0| |A4:**1SP2E0| that activates c-Jun N-terminal kinase (JNK)/p38 mitogen-activated protein kinases, |A1:**1SP2E0| |A2:**1SP2E0+| |A4:**2SP3E0+| |A5:**1SP3E0+| components of a signaling cascade that regulates cell survival in response to stress. |A1:**2SP3E0| |A2:**2SP3E0| |A3:**2SP3E0| |A4:**3SP3E0| |A5:**2SP3E0|
				Annotation	1SP2E0 1SP2E0 2SP3E0	1SP2E0+ 1SP2E0+ 2SP3E0	1SP2E0 2SP3E0 2SP3E0	1SP2E0 2SP3E0+ 3SP3E0	1SP3E0+ 1SP3E0+ 2SP3E0
				Evidence	1 1 1	1 1 1	1 1 1	1 1 1	1 1 1
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	6 6 7	6 6 7	6 7 7	6 7 7	7 7 7
142	8373	12399371_227	The substantial (11%) and significant gain in the average fitness of the mutator subpopulation in population Ara+3 between generations 3000 and 3500 was consistent with hitchhiking. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3+| |A4:**1SP3E3+| |A5:**1GP3E0|
				Annotation	1GP3E3	1GP3E3	1SP3E3+	1SP3E3+	1GP3E0
				Evidence	4	4	4	4	1
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
143	7331	11430806_151	This increase was evident both in cell body number and the number of terminals in the IPL (Figure 5B). |A1:**1GP3E3+| |A2:**1SP3E3+| |A3:**1SP3E3| |A4:**1SP3E3+| |A5:**1GP3E3|
				Annotation	1GP3E3+	1SP3E3+	1SP3E3	1SP3E3+	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
144	8498	12189148_21	D, recombinant PGAM-B protein was affinity-purified and subjected to in vitro kinase reaction with purified, constitutively active Pak1. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	2	2
				Polarity	7	7	7	7	7
145	3901	9390512_272	Both linkage and association methods have been developed to map QTLs (Risch and Zhang 1995 ), |A1:**1MP3E2| |A2:**1MP3E2| and successes have been reported for reading disability ( Cardon et al. 1994 ). |A3:**1SP3E2| |A1:**2GP3E2| |A2:**2GP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1MP3E2 2GP3E2	1MP3E2 2GP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1GP3E2 1GP3E2
				Evidence	3 3	3 3	3 3	3 3	3 3
				Focus	2 1	2 1	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
146	2727	11583618_98	Furthermore, coexpression of a dominant-negative HPC2 (described below) reversed this Rb- and HPC2-dependent repression of the SV40 promoter/enhancer (Figure 1A). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3-| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3-	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
147	3990	12108620_6	Results suggest that individuals with AS/HFA have difficulty extracting mental state information from vocalizations. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP2E3| |A4:**1SP3E1| |A5:**1SP2E1|
				Annotation	1GP3E3	1GP3E3	1SP2E3	1SP3E1	1SP2E1
				Evidence	4	4	4	2	2
				Focus	1	1	4	4	4
				Polarity	7	7	6	7	6
148	6965	12686140_55	Moreover, it is known that drosophila dishevelled, regulator of Wnt signaling, |A5:**1GP3E1| is able to up-regulate -catenin levels and activate c-jun through the JNKs. [11 and 13]. |A1:**1SP3E2+| |A2:**1SP3E2+| |A3:**1SP2E2| |A4:**1SP3E2+| |A5:**2SP3E2+|
				Annotation	1SP3E2+ 1SP3E2+	1SP3E2+ 1SP3E2+	1SP2E2 1SP2E2	1SP3E2+ 1SP3E2+	1GP3E1 2SP3E2+
				Evidence	3 3	3 3	3 3	3 3	2 3
				Focus	4 4	4 4	4 4	4 4	1 4
				Polarity	7 7	7 7	6 6	7 7	7 7
149	1774	12967567_9	In metazoan cells, the nuclear envelope becomes reorganized at mitosis, |A1:**1SP3E0| and ultimately its disassembly is key to accurate inheritance of both genomic DNA and nuclear envelope components. |A1:**2GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0 2GP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	4 1	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
150	2628	10383421_17	It is particularly interesting that the domains labeled with the Bpa22- and Bpa6-containing secretin analogues were both near the end of the amino terminus of the secretin receptor. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E3	1SP3E1	1SP3E0	1SP3E0	1SP3E1
				Evidence	4	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
151	519	12033758_2	It is seen in patients with healthy joints as well as those with somatic dysfunction. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E1
				Evidence	1	1	1	1	2
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
152	7991	10733592_145	To identify cis-acting elements involved in hormone control of bcl-2 expression, we have made a reporter construct in which the bcl-2 P1 promoter, from 1,623 to 1,390 bp upstream of the translation start site, was cloned 5' to the CAT gene (P1 construct). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SMP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1SMP3E3
				Evidence	4	4	1	1	4
				Focus	4	4	4	4	6
				Polarity	7	7	7	7	7
153	6762	9262333_183	More recently, it has been demonstrated that the suppressant effects of 8-OHDPAT on the basal firing rate of spontaneously active cells in the mPFCx is potentiated by concurrent iontophoretic administration of either of the 5-HT2A antagonists ritanserin and MDL 100,907 (Ashby et al., 1994). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1MP3E12|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1MP3E12
				Evidence	3	3	3	3	2
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
154	7018	12871700_429	S. Ikeda, S. Kishida, H. Yamamoto, H. Murai, S. Koyama and A. Kikuchi, |A3:**1GP3E0| Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-beta and beta-catenin |A1:**1SP3E3| |A2:**1SP3E3| |A5:**1SP3E2| and |A4:**1SP3E0| promotes GSK-3beta-dependent phosphorylation and beta-catenin. |A1:**2SP3E3+| |A2:**2SP3E3+| |A3:**1SP3E0| |A4:**2SP3E0+| |A5:**2SP3E2+|
				Annotation	1SP3E3 1SP3E3 2SP3E3+ 2SP3E3+	1SP3E3 1SP3E3 2SP3E3+ 2SP3E3+	1GP3E0 1SP3E0 1SP3E0 1SP3E0	1SP3E0 1SP3E0 1SP3E0 2SP3E0+	1SP3E2 1SP3E2 2SP3E2+ 2SP3E2+
				Evidence	4 4 4 4	4 4 4 4	1 1 1 1	1 1 1 1	3 3 3 3
				Focus	4 4 4 4	4 4 4 4	1 4 4 4	4 4 4 4	4 4 4 4
				Polarity	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7
155	2723	12359842_24	During the whole experiment, the position of the fly in the chamber is monitored, and the fraction of time the flies spent on the "`unpunished"` side is calculated. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**1MP2E3|
				Annotation	1MP3E3	1MP3E3	1SP3E0	1SP3E3	1MP2E3
				Evidence	4	4	1	4	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	6
156	2861	9512517_281	By analogy to the role that vertebrate myb genes are thought to play in cell cycle regulation, |A1:**1SP1E0| |A3:**1SP1E1| |A5:**1GP3E0| Dm myb may also participate in regulation of the G1/S transition, |A1:**2SP1E0| |A2:**1SP1E0| |A3:**2SP2E0| |A5:**2GP1E0| but our studies indicate that it is not required for DNA synthesis in endocycling cells. |A1:**3SN3E3| |A2:**2SN3E3| |A3:**3SN3E3| |A4:**1SP3E3| |A5:**3GN3E3|
				Annotation	1SP1E0 2SP1E0 3SN3E3	1SP1E0 1SP1E0 2SN3E3	1SP1E1 2SP2E0 3SN3E3	1SP3E3 1SP3E3 1SP3E3	1GP3E0 2GP1E0 3GN3E3
				Evidence	1 1 4	1 1 4	2 1 4	4 4 4	1 1 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	5 5 1	5 5 1	5 6 1	7 7 7	7 5 1
157	8510	11980919_239	When overexpressed, many of these "`BH3-only"` proteins (e.g., BIM and HRK), like their multidomain cousins, localize to mitochondria, |A4:**1SP3E3+| cause cyt c release, |A1:**1SP3E2| |A3:**1SP3E3+| |A4:**2SP3E0| and induce cell death |A1:**2SP3E2| |A2:**1SP3E2| |A5:**1SP3E2+| that can be attenuated by caspase inhibition |A5:**2SP3E2-| or cooverexpression of antiapoptotic BCL-2 proteins ( Imaizumi et al., 1997; Inohara et al., 1997; O'Connor et al., 1998). |A1:**3SN1E2| |A2:**2SP1E2| |A3:**2SP3E2+| |A4:**3SP3E2+| |A5:**3SP3E2+|
				Annotation	1SP3E2 1SP3E2 2SP3E2 3SN1E2 3SN1E2	1SP3E2 1SP3E2 1SP3E2 2SP1E2 2SP1E2	1SP3E3+ 1SP3E3+ 2SP3E2+ 2SP3E2+ 2SP3E2+	1SP3E3+ 2SP3E0 3SP3E2+ 3SP3E2+ 3SP3E2+	1SP3E2+ 1SP3E2+ 1SP3E2+ 2SP3E2- 3SP3E2+
				Evidence	3 3 3 3 3	3 3 3 3 3	4 4 3 3 3	4 1 3 3 3	3 3 3 3 3
				Focus	4 4 4 4 4	4 4 4 4 4	4 4 4 4 4	4 4 4 4 4	4 4 4 4 4
				Polarity	7 7 7 3 3	7 7 7 5 5	7 7 7 7 7	7 7 7 7 7	7 7 7 7 7
158	896	12726860_121	To more directly assess whether loss of E2F3 can lead to aneuploidy, |A5:**1SP1E0| chromosome numbers were counted in cells from early and late passage populations. |A5:**2SP3E3| |A1:**1SP1E3| |A2:**1SP1E3| |A3:**1SP3E3| |A4:**1MP3E3|
				Annotation	1SP1E3 1SP1E3	1SP1E3 1SP1E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3	1SP1E0 2SP3E3
				Evidence	4 4	4 4	4 4	4 4	1 4
				Focus	4 4	4 4	4 4	2 2	4 4
				Polarity	5 5	5 5	7 7	7 7	5 7
159	7256	9736749_103	These deformations, shown as either simple surface displacements or z-scores, were similar on each side and involved specific subregions of the head and body of the hippocampus. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1SP3E0	1SP3E1
				Evidence	4	4	4	1	2
				Focus	1	1	4	4	4
				Polarity	7	7	7	7	7
160	237	12810961_7	Cells expressing TGase2 antisense RNA are less sensitive to apoptosis induced by various agents, |A1:**1SP3E0-| |A2:**1SP3E0-| |A5:**1SN3E1| whereas cells overexpressing TGase2 have increased sensitivity ( 13, 14). |A1:**2SP3E2+| |A2:**2SP3E2+| |A3:**1SP3E2| |A4:**1SP3E3+| |A5:**2SP3E2+|
				Annotation	1SP3E0- 2SP3E2+	1SP3E0- 2SP3E2+	1SP3E2 1SP3E2	1SP3E3+ 1SP3E3+	1SN3E1 2SP3E2+
				Evidence	1 3	1 3	3 3	4 4	2 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	1 7
161	9478	10790415_521	In using models M9 - M11 as well as other continuous distribution models not based on the beta distribution (M5, M6, M12, and M13), |A1:**1GN0E0| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1GN3E0| it is important to examine the discrete distributions to see whether there is any category with omega > 1. |A1:**2GP0E0| |A2:**1SN3E0| |A3:**2SP3E0| |A4:**2SP3E0| |A5:**2GP3E0|
				Annotation	1GN0E0 2GP0E0	1SN3E0 1SN3E0	1SN3E0 2SP3E0	1SN3E0 2SP3E0	1GN3E0 2GP3E0
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	4 4	1 1	1 7	1 7	1 7
162	5589	9560377_181	One important qualification to our conclusions relates to the possibility that |A5:**1SP2E3| the dnaE antimutator alleles not only reduce normal DNA replication errors |A3:**1SP1E3| but also reduce mutations at DNA lesions. |A3:**2SN3E0| |A1:**1GP3E1-| |A2:**1SP3E1-| |A4:**1SP2E3-| |A5:**2SP3E0-|
				Annotation	1GP3E1- 1GP3E1- 1GP3E1-	1SP3E1- 1SP3E1- 1SP3E1-	1SP1E3 1SP1E3 2SN3E0	1SP2E3- 1SP2E3- 1SP2E3-	1SP2E3 2SP3E0- 2SP3E0-
				Evidence	2 2 2	2 2 2	4 4 1	4 4 4	4 1 1
				Focus	1 1 1	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	7 7 7	5 5 1	6 6 6	6 7 7
163	3519	9039265_27	Affected mice that survive past two months of age recover much of their immune function and body weight and live normal lifespans, |A1:**1GP3E2| |A2:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E2+| but exhibit reduced fertility (Dung and Swigart, 1971 Dung and Swigart, 1972 ; Dung, 1977). |A1:**2GP3E2-| |A2:**1SP3E2-| |A3:**1SP3E2| |A4:**2SP3E2-| |A5:**2SP3E2-|
				Annotation	1GP3E2 2GP3E2-	1SP3E0 1SP3E2-	1SP3E2 1SP3E2	1SP3E0 2SP3E2-	1SP3E2+ 2SP3E2-
				Evidence	3 3	1 3	3 3	1 3	3 3
				Focus	1 1	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
164	4092	9430651_126	Introduction of a DSB would result in recruitment of a Ku heterodimer to each end. |A1:**1GP2E0| |A2:**1SP2E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E1|
				Annotation	1GP2E0	1SP2E0	1SP3E0	1SP3E0	1GP3E1
				Evidence	1	1	1	1	2
				Focus	1	4	4	4	1
				Polarity	6	6	7	7	7
165	9798	9110171_253	Therefore, we hypothesize that all of the conserved noncoding segments are (or were) required functionally for the proper expression of the btk locus. |A1:**1GP2E3| |A2:**1SP2E3| |A3:**1SP2E0| |A4:**1SP3E1| |A5:**1GP1E3|
				Annotation	1GP2E3	1SP2E3	1SP2E0	1SP3E1	1GP1E3
				Evidence	4	4	1	2	4
				Focus	1	4	4	4	1
				Polarity	6	6	6	7	5
166	3328	11156984_154	Those cases, underlined in Table 3, may be due either to other constraints on codon usage, |A4:**1SP2E3| |A5:**1SP3E3| such as selection or dinucleotide bias (K ARLIN and BURGE 1995 ), |A4:**2SP3E2| |A5:**2SP3E2| or to an artifact of insufficient sampling. |A4:**3SP3E0| |A1:**1SP1E23| |A2:**1SP2E23| |A3:**1SP1E3| |A5:**3SP3E3|
				Annotation	1SP1E23 1SP1E23 1SP1E23	1SP2E23 1SP2E23 1SP2E23	1SP1E3 1SP1E3 1SP1E3	1SP2E3 2SP3E2 3SP3E0	1SP3E3 2SP3E2 3SP3E3
				Evidence	3 3 3	3 3 3	4 4 4	4 3 1	4 3 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	5 5 5	6 6 6	5 5 5	6 7 7	7 7 7
167	8066	11472942_112	Mutator strains eliminate the need for chemical or physical mutagenesis, |A5:**1SP3E0| but their application has been limited by their genetic instability and by the need to stabilize the strains after successful evolution. |A5:**2SN3E0| |A1:**1GP1E1| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0|
				Annotation	1GP1E1 1GP1E1	1SP3E1 1SP3E1	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 2SN3E0
				Evidence	2 2	2 2	1 1	1 1	1 1
				Focus	1 1	4 4	4 4	4 4	4 4
				Polarity	5 5	7 7	7 7	7 7	7 1
168	8788	12421717_1	In the amphipod crustacean, Parhyale hawaiensis, the first few embryonic cleavages are total and generate a stereotypical arrangement of cells. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP1E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1GP3E0	1SP3E0	1SP1E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	4
				Polarity	7	7	5	7	7
169	918	12821645_53	Northern blot analysis revealed strong Fatp4 mRNA expression in Fatp4 +/+ intestine, |A3:**1MSP3E3| |A1:**1SP3E3+| |A5:**1SP3E3+| whereas Fatp4 mRNA in Fatp4 -/- intestine could not be detected, |A3:**2SN3E3| indicating a severe loss-of-function allele of Fatp4 (Fig. 1 D). |A3:**3SP3E3| |A1:**2SN3E3-| |A2:**1SP3E3+| |A4:**1MN3E3-| |A5:**2SN3E3-|
				Annotation	1SP3E3+ 2SN3E3- 2SN3E3-	1SP3E3+ 1SP3E3+ 1SP3E3+	1MSP3E3 2SN3E3 3SP3E3	1MN3E3- 1MN3E3- 1MN3E3-	1SP3E3+ 2SN3E3- 2SN3E3-
				Evidence	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Focus	4 4 4	4 4 4	6 4 4	2 2 2	4 4 4
				Polarity	7 1 1	7 7 7	7 1 7	1 1 1	7 1 1
170	8835	9727029_208	No other binding partner of SOCS-2 has been reported; |A4:**1SP3E3| specifically, |A3:**1SN3E1| SOCS-2 does not bind to JAK-2 (9). |A3:**2SN3E2| |A1:**1SN3E2| |A2:**1SN3E2| |A4:**2SN3E0| |A5:**1SN3E2|
				Annotation	1SN3E2 1SN3E2 1SN3E2	1SN3E2 1SN3E2 1SN3E2	1SN3E1 1SN3E1 2SN3E2	1SP3E3 2SN3E0 2SN3E0	1SN3E2 1SN3E2 1SN3E2
				Evidence	3 3 3	3 3 3	2 2 3	4 1 1	3 3 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	1 1 1	1 1 1	1 1 1	7 1 1	1 1 1
171	4961	10629051_246	We have previously shown the importance of the p38 MAP kinase pathway |A5:**1SP3E1| on the production of IFN-gamma in CD4+ Th1 effector cells (44). |A5:**2SP3E2+| |A1:**1SP2E2| |A2:**1SP2E2| |A3:**1SP3E2| |A4:**1SP3E2|
				Annotation	1SP2E2 1SP2E2	1SP2E2 1SP2E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E1 2SP3E2+
				Evidence	3 3	3 3	3 3	3 3	2 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	6 6	6 6	7 7	7 7	7 7
172	1926	9750192_199	For the first primer set (197F/199R) the PCR conditions were as follows: initial denaturation at 95 degrees C for 5 min, denaturation at 95 degrees C for 15 sec, |A5:**1SP3E3-| annealing at 56 degrees C for 15 sec, and extension at 72 degrees C for 30 sec for a total of 30 cycles. |A5:**2SP3E3+| |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1MP3E3|
				Annotation	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3	1SP3E3- 2SP3E3+
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	4 4	2 2	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
173	9131	11381111_42	Using the N-back fMRI paradigm, Mattay et al. recently reported analogous inefficiency in hypodopaminergic patients with Parkinson's disease. |A1:**1MP3E1| |A2:**1SP3E1| |A3:**1SP3E1| |A4:**1SP3E3| |A5:**1MP3E2|
				Annotation	1MP3E1	1SP3E1	1SP3E1	1SP3E3	1MP3E2
				Evidence	2	2	2	4	3
				Focus	2	4	4	4	2
				Polarity	7	7	7	7	7
174	8450	9139668_25	Fig. 3. Induction of boxA-lacZ RNA synthesis in nusAcs10 and nusA + strains harboring pUV16. |A1:**1SP3E3+| |A2:**1SP3E3+| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3+|
				Annotation	1SP3E3+	1SP3E3+	1SP3E3	1SP3E3	1SP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
175	3660	11395449_46	Primer extension determination of the processing cuts on the RNA transcripts was performed according to techniques described previously (24). |A1:**1MP2E2| |A2:**1MP2E2| |A3:**1SP3E2| |A4:**1MP3E2| |A5:**1MP3E2|
				Annotation	1MP2E2	1MP2E2	1SP3E2	1MP3E2	1MP3E2
				Evidence	3	3	3	3	3
				Focus	2	2	4	2	2
				Polarity	6	6	7	7	7
176	5172	12820963_54	The ratio of phospho-c-Jun to c-Jun is plotted in the histogram (upper right) as the mean plus-or-minus SD of three experiments (*p < 0.05). |A1:**1MP2E3| |A2:**1MP2E3| |A3:**1SP3E3| |A4:**1GP3E0| |A5:**1MP3E3|
				Annotation	1MP2E3	1MP2E3	1SP3E3	1GP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	2	2	4	1	2
				Polarity	6	6	7	7	7
177	8506	7592715_64	The reason for this is not clear |A5:**1GN3E3| but could be due to the unfavorable cleavage bias of A and C residues by the nuclease (see lanes 1 and 2 in Fig. 3 B). |A5:**2SP2E3| |A1:**1SN1E3| |A2:**1SN2E3| |A3:**1SP0E3| |A4:**1SP2E3|
				Annotation	1SN1E3 1SN1E3	1SN2E3 1SN2E3	1SP0E3 1SP0E3	1SP2E3 1SP2E3	1GN3E3 2SP2E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	1 4
				Polarity	3 3	2 2	4 4	6 6	1 6
178	3364	9244305_109	To identify the cleavage site, the in vitro-translated MEKK-1 protein was cleaved with apoptotic MDCK cell extract or caspase-3 and subjected to radiolabeled sequencing (see Experimental Procedures). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
179	4602	10799487_99	Similar phenomena were observed with the other T213 and T214 mutants, |A3:**1SP3E3| but only in the case of T214V were the low and high spin species almost completely resolved chromatographically. |A3:**2MSP1E3| |A1:**1MP3E3| |A2:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1SP3E3 2MSP1E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	4 6	2 2	2 2
				Polarity	7 7	7 7	7 5	7 7	7 7
180	5777	12663533_48	Nucleic acid preparations and manipulations followed standard protocols (A USUBEL et al. 2002 ). |A2:**1SP2E2| |A1:**1GP2E2| |A3:**1SP3E2| |A4:**1SP3E0| |A5:**1MP3E2|
				Annotation	1GP2E2	1SP2E2	1SP3E2	1SP3E0	1MP3E2
				Evidence	3	3	3	1	3
				Focus	1	4	4	4	2
				Polarity	6	6	7	7	7
181	7886	9497367_163	To test this possibility, as a model unstable protein we have chosen I-kappaB, which becomes extremely short lived after exposure to TNFalpha. |A1:**1SP2E3| |A2:**1SP2E3| |A3:**1SP3E3| |A4:**1SP3E1| |A5:**1SP3E3|
				Annotation	1SP2E3	1SP2E3	1SP3E3	1SP3E1	1SP3E3
				Evidence	4	4	4	2	4
				Focus	4	4	4	4	4
				Polarity	6	6	7	7	7
182	3952	9671490_204	Expression of this mutant beta-catenin with LEF-1 in transfected Neuro2A cells |A5:**1SP3E3| stimulated the activity of the LEF-CAT reporter gene to a level similar to that with the wt beta-catenin (Fig. 5C). |A5:**2SP3E3+| |A1:**1SP3E3+| |A2:**1SP3E3+| |A3:**1SP3E3| |A4:**1SP3E3|
				Annotation	1SP3E3+ 1SP3E3+	1SP3E3+ 1SP3E3+	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 2SP3E3+
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
183	5747	9422604_61	A 2.7-kb KpnI- EcoRI fragment from pRHB614 was ligated to pBluescript II KS digested with KpnI and EcoRI, yielding pRHB599. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1SP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	2	4	2
				Polarity	7	7	7	7	7
184	6255	10380930_360	The tensor B22 (6.80) is substantially smaller than B11 (36.94) and B33 (45.70). |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1GP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1GP3E0	1GP3E0	1GP3E0	1SP3E0	1GP3E3
				Evidence	1	1	1	1	4
				Focus	1	1	1	4	1
				Polarity	7	7	7	7	7
185	7026	10890911_19	Activation of Wnt signaling by binding of Wnt to the Frizzled family of receptors |A5:**1SP3E0| inhibits glycogen-synthase kinase-dependent phosphorylation of beta-catenin |A1:**1SN3E0-| |A2:**1SP3E0-| and |A5:**2SP3E0-| results in an increase in beta-catenin protein levels. |A5:**3SP3E0+| |A1:**2SP3E0+| |A2:**2SP3E0+| |A3:**1SP3E0| |A4:**1SP3E0+|
				Annotation	1SN3E0- 1SN3E0- 2SP3E0+ 2SP3E0+	1SP3E0- 1SP3E0- 2SP3E0+ 2SP3E0+	1SP3E0 1SP3E0 1SP3E0 1SP3E0	1SP3E0+ 1SP3E0+ 1SP3E0+ 1SP3E0+	1SP3E0 2SP3E0- 2SP3E0- 3SP3E0+
				Evidence	1 1 1 1	1 1 1 1	1 1 1 1	1 1 1 1	1 1 1 1
				Focus	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4
				Polarity	1 1 7 7	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7
186	5538	11533250_217	The kinetics of Wnt pathway-associated genes (encoding beta-catenin, TCF4, Dishevelled-1, Frizzled, axin, and APC) are shown. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E1	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	2	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
187	6368	9145916_173	The same reticular pattern of receptor immunofluorescence was seen in the dimmest and the brightest cells. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1MP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	2	4	4	4	4
				Polarity	7	7	7	7	7
188	3147	9418906_104	Each DNA fragment was subcloned into the respective restriction sites of the pUAST vector. |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1SP3E0| |A5:**1SP3E3|
				Annotation	1SP3E3	1MP3E3	1MP3E3	1SP3E0	1SP3E3
				Evidence	4	4	4	1	4
				Focus	4	2	2	4	4
				Polarity	7	7	7	7	7
189	3193	10611225_196	Twenty percent of the input His-tagged protein was subjected to SDS-PAGE followed by Western blotting with anti-His antibody (upper panel). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
190	7754	11371357_206	GFP, a self-replenishing fluorescent marker, allows identification and isolation of transferred effector cells in a real-time mode, |A2:**1SP3E0| |A3:**1SP3E0| |A5:**1GP3E2| while it does not interfere with the T cells' encephalitogenic function (Flu gel et al., 1999). |A2:**1SN3E2| |A1:**1GP3E2| |A3:**2SN3E2| |A4:**1SP3E2| |A5:**2GN3E2|
				Annotation	1GP3E2 1GP3E2	1SP3E0 1SN3E2	1SP3E0 2SN3E2	1SP3E2 1SP3E2	1GP3E2 2GN3E2
				Evidence	3 3	1 3	1 3	3 3	3 3
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	7 7	7 1	7 1	7 7	7 1
191	5965	9844016_84	The linear range of amplification was determined in a 30-cycle RT-PCR amplification of reverse transcribed, randomly primed cDNAs, with increasing amounts (0-400 ng) of starting total RNA obtained from one schizophrenic brain (Fig. 3 A). |A1:**1SP3E3+| |A2:**1MP3E3| |A3:**1MSP3E3+| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3+	1MP3E3	1MSP3E3+	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	2	6	4	2
				Polarity	7	7	7	7	7
192	2567	10523653_174	A 750-bp PstI fragment internal to the PTP2 open reading frame, a 1-kb ClaI fragment internal to the PTP3 open reading frame, and a 1.1-kb BglII- ClaI fragment from TUB1 were used to produce 32P-labeled probes (63). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1MSP3E3| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E23	1SP3E23	1MSP3E3	1SP3E2	1SP3E2
				Evidence	3	3	4	3	3
				Focus	4	4	6	4	4
				Polarity	7	7	7	7	7
193	5720	10671457_74	Samples were incubated at 60 degrees C for 5 min, |A5:**1MP3E3| and the reaction was stopped by adding 25 mul of 20% formic acid. |A5:**2MP3E3-| |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1MP3E3|
				Annotation	1MP3E3 1MP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3	1MP3E3 2MP3E3-
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	4 4	4 4	2 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
194	5168	12058040_46	Arrow indicates the Pus3p protein; M indicates molecular weight markers in thousands. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E3	1GP3E3
				Evidence	1	1	1	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
195	4953	12481028_7	Valproic acid (2 mmol/kg for 15 days, twice a day) reverted L-methionine-induced down-regulation of reelin and GAD67 in both WT and heterozygous reeler mice, |A5:**1MP3E3| suggesting an epigenetic action through the inhibition of histone deacetylases. |A5:**2SP2E0| |A1:**1SN3E3-| |A2:**1SN3E3-| |A3:**1SP3E3-| |A4:**1SN2E1-|
				Annotation	1SN3E3- 1SN3E3-	1SN3E3- 1SN3E3-	1SP3E3- 1SP3E3-	1SN2E1- 1SN2E1-	1MP3E3 2SP2E0
				Evidence	4 4	4 4	4 4	2 2	4 1
				Focus	4 4	4 4	4 4	4 4	2 4
				Polarity	1 1	1 1	7 7	2 2	7 6
196	8672	11500393_48	Clinical isolates of Pseudomonas aeruginosa and Staphylococcus aureus were obtained from the clinical microbiology laboratory at the Shriners Hospital for Children, Galveston Burns Unit, and were heat-killed at 56 degrees C for 1 h. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
197	7727	12087098_77	The kinase activity was determined as the ratio of radioactive signal versus Western signal. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E3	1MP3E3
				Evidence	4	4	1	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
198	334	9570815_130	The analysis in Figure 1 B suggests that in five cases the side cuts were largely successful. |A1:**1GP2E3| |A2:**1GP2E3| |A3:**1GP2E3| |A4:**1SP2E3| |A5:**1GP3E3|
				Annotation	1GP2E3	1GP2E3	1GP2E3	1SP2E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	1	4	1
				Polarity	6	6	6	6	7
199	2922	10197535_25	Mutations in the M3C and M4N segments, |A5:**1GP3E0| but not in the preM1 segment, |A5:**2GN3E0| exhibited shifts of the reversal potential for Ca2+ Ca2 subsequent to covalent modification. |A5:**3GP3E0| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SN3E3| |A4:**1SN3E3|
				Annotation	1SP3E3 1SP3E3 1SP3E3	1SP3E3 1SP3E3 1SP3E3	1SN3E3 1SN3E3 1SN3E3	1SN3E3 1SN3E3 1SN3E3	1GP3E0 2GN3E0 3GP3E0
				Evidence	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	7 7 7	7 7 7	1 1 1	1 1 1	7 1 7
200	4240	11909946_1	Hypoxia (low-oxygen tension) is an important physiological stress that influences responses to a wide range of pathologies, including stroke, infarction, and tumorigenesis. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
201	7837	12359197_4	The daily aspiration required significantly more attendances for aspiration (P<0.005) |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP2E3| and the time from surgery to final aspiration was not reduced. CONCLUSION: |A1:**2GN3E3| |A2:**1SN3E3| |A3:**1SN3E3| |A4:**1GN2E0| |A5:**1SP3E3|
				Annotation	1GP3E3 2GN3E3	1SP3E3 1SN3E3	1SP2E3 1SN3E3	1GN2E0 1GN2E0	1SP3E3 1SP3E3
				Evidence	4 4	4 4	4 4	1 1	4 4
				Focus	1 1	4 4	4 4	1 1	4 4
				Polarity	7 1	7 1	6 1	2 2	7 7
202	7243	11278880_53	CD9P-1 is the protein coded by the KIAA1436 gene ( ). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E0	1SP3E0	1GP3E2
				Evidence	3	3	1	1	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
203	2163	11948703_2	Although its mechanism of action remains unknown, |A3:**1SP0E0| |A5:**1GP0E0| irradiated T-helper cell-induced immunosuppression is the main theory. |A3:**1SP2E0| |A1:**1GP0E0| |A2:**1SN0E0| |A4:**1SP0E0| |A5:**2SP1E0|
				Annotation	1GP0E0 1GP0E0	1SN0E0 1SN0E0	1SP0E0 1SP2E0	1SP0E0 1SP0E0	1GP0E0 2SP1E0
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	1 1	4 4	4 4	4 4	1 4
				Polarity	4 4	4 4	4 6	4 4	4 5
204	8117	11021528_12	This interaction results in an increased T cell proliferation, IL-2 production, |A1:**1SP3E3+| and resistance to apoptosis (Linsley et al. 1991a ; Croft et al. 1992). |A1:**2SP3E23+| |A2:**1SP3E23+| |A3:**1SP3E2| |A4:**1SP3E2+| |A5:**1SP3E2+|
				Annotation	1SP3E3+ 2SP3E23+	1SP3E23+ 1SP3E23+	1SP3E2 1SP3E2	1SP3E2+ 1SP3E2+	1SP3E2+ 1SP3E2+
				Evidence	4 3	3 3	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
205	1934	9437015_85	An intensity ratio of 1.0 represented cytoplasmic fluorescence equal to that in the nucleus. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP2E3|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1SP2E3
				Evidence	1	1	1	1	4
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	6
206	5208	12620409_324	The gradients were centrifuged in an SW41 Beckman rotor at 38,000 rpm for 120 min at 4 degrees C. Fourteen fractions of equal volume (750 l) were collected from the bottom of the tubes. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
207	2007	11861554_195	We conclude that rad-51 is involved in resistance to IR during embryonic growth. |A1:**1SP3E1| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3-| |A5:**1SP3E3|
				Annotation	1SP3E1	1SP3E3	1SP3E3	1SP3E3-	1SP3E3
				Evidence	2	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
208	2498	11438670_259	These cells were also stained for the mitosis-specific phosphorylated form of histone H3 to unambiguously distinguish mitotic cells (18). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E3| |A4:**1SP0E0| |A5:**1SP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E3	1SP0E0	1SP3E2
				Evidence	3	3	4	1	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	4	7
209	6773	11257128_140	Demyelination often began at one end of the myelin sheath, |A5:**1SP3E3-| progressing from the paranodal region to the Schwann cell internode (data not shown). |A5:**2SP3E3+| |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3|
				Annotation	1SP3E1 1SP3E1	1SP3E1 1SP3E1	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3- 2SP3E3+
				Evidence	2 2	2 2	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
210	8119	10508204_96	Tissues comprising liver, heart, lungs, intestine and stomach, spleen, kidneys, and aorta were excised, blotted dry on lint-free tissues, and placed in sample containers on ice to be stored at -80 degrees C until analysis. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	4	2
				Polarity	7	7	7	7	7
211	3966	12107429_5	Northern blotting of embryonic stages demonstrated a 3.2-kb transcript present in several embryonic tissues, including kidney, brain, heart, and lung, in a fashion confirmatory with the RNA-fingerprinting data. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1MSP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1SP3E3	1MSP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	4	6	2	2
				Polarity	7	7	7	7	7
212	9283	11731474_1	The Wnt-responsive transcription factor LEF1 can activate transcription in association with beta-catenin |A1:**1SP2E0+| |A2:**1SP1E0+| |A5:**1SP3E0+| and repress transcription in association with Groucho. |A1:**2SN3E0| |A2:**1SP3E0-| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**2SP3E0-|
				Annotation	1SP2E0+ 2SN3E0	1SP1E0+ 1SP3E0-	1SP3E0 1SP3E0	1SP3E3 1SP3E3	1SP3E0+ 2SP3E0-
				Evidence	1 1	1 1	1 1	4 4	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	6 1	5 7	7 7	7 7	7 7
213	5900	12530981_103	Cell lysates from Tpn / cells +/ mK3 /cells +/mK3 and +/ Tpn +/Tpn reconstitution were blotted with anti-tapasin, -mK3, and -GFP antibodies. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
214	4945	11466270_83	Outer membrane protein profiles (12) of bacteria and the ability of bacteria to attach to plastic ( 35) were assayed as described elsewhere. |A1:**1GP0E23| |A2:**1SP3E23| |A3:**1SP3E2| |A4:**1SP3E1| |A5:**1MP3E2|
				Annotation	1GP0E23	1SP3E23	1SP3E2	1SP3E1	1MP3E2
				Evidence	3	3	3	2	3
				Focus	1	4	4	4	2
				Polarity	4	7	7	7	7
215	7607	10348843_160	Deletion of MID2 in two viable but slow-growing beta-1,6-glucan beta-1, 6-glucan synthesis mutants, kre6delta (42) and kre9delta (5), |A4:**1SP3E2-| |A5:**1SP3E2| partially restores growth rate (Fig. 3A, and B). |A4:**2SP2E3| |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP1E2| |A5:**2SP3E3+|
				Annotation	1SP3E23 1SP3E23	1SP3E23 1SP3E23	1SP1E2 1SP1E2	1SP3E2- 2SP2E3	1SP3E2 2SP3E3+
				Evidence	3 3	3 3	3 3	3 4	3 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	5 5	7 6	7 7
216	1428	7592782_12	There are two optima for the inactivation rate: one at pH 6.0-7.0, and the other at approximately pH 4.0 (Fig. 2). |A1:**1SP3E3| |A2:**1SP3E3-| |A3:**1SP3E3| |A4:**1SP2E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3-	1SP3E3	1SP2E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	6	7
217	4047	9971740_35	More recent ultrastructural analyses have shown that this axonal enlargement is caused by an accumulation of neurofilaments |A4:**1SP3E1| and membranous organelles proximal to the site of constriction (e.g., Schmidt and Plurad, 1985 ; LeBeau et al., 1988 ). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP2E2| |A4:**2SP3E2| |A5:**1SP3E2+|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP2E2 1SP2E2	1SP3E1 2SP3E2	1SP3E2+ 1SP3E2+
				Evidence	3 3	3 3	3 3	2 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	6 6	7 7	7 7
218	9917	12091905_1	Staphylococcus aureus is a human pathogen that secretes proteins that contribute to bacterial colonization. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0+|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0+
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
219	8689	9390512_167	It has been estimated that systematic mapping by association requires a marker map of density at least 100-fold greater greaterR than that for linkage mapping. |A1:**1GP2E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP3E1+| |A5:**1SP2E1|
				Annotation	1GP2E0	1SP2E0	1SP2E0	1SP3E1+	1SP2E1
				Evidence	1	1	1	2	2
				Focus	1	4	4	4	4
				Polarity	6	6	6	7	6
220	7329	12230083_1	Mental health services in the treatment of late-life depression are critical in the primary care arena. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1SP3E0| |A4:**1GP3E0| |A5:**1SP3E0|
				Annotation	1GP3E0	1GP3E0	1SP3E0	1GP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	1	1	4	1	4
				Polarity	7	7	7	7	7
221	3737	9488491_120	Supershift experiments with antibodies against E2F indicated that E2F4 is the major family member |A5:**1MP3E3| whose levels were increased in the presence of TAg (data not shown). |A5:**2MP3E3+| |A1:**1SP3E1+| |A2:**1SP3E1+| |A3:**1MSP2E3| |A4:**1MP3E3+|
				Annotation	1SP3E1+ 1SP3E1+	1SP3E1+ 1SP3E1+	1MSP2E3 1MSP2E3	1MP3E3+ 1MP3E3+	1MP3E3 2MP3E3+
				Evidence	2 2	2 2	4 4	4 4	4 4
				Focus	4 4	4 4	6 6	2 2	2 2
				Polarity	7 7	7 7	6 6	7 7	7 7
222	7415	12370247_99	Akr1p by itself is apparently sufficient for activity. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP2E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP2E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	6	7
223	687	11950881_2	The cadherin family of cell adhesion receptors, located in the adherens junction, interact homophilically to mediate strong cell-cell adhesion. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
224	5816	11438517_147	Cells stably expressing 3Rtau or 4Rtau were treated as described for Fig. 5. |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E3| Cells were scraped into sample buffer without DTT and proteins separated by SDS-PAGE, Western-blotted, and probed with a polyclonal antibody to tau, TP70. a, 3RtauCHO cells; b, 4RtauCHO cells. |A2:**1MP3E3| |A1:**1MP3E3| |A3:**2MP3E3| |A4:**2MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 1MP3E3	1SP3E3 1MP3E3	1MP3E3 2MP3E3	1SP3E3 2MP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	4 2	2 2	4 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
225	2591	9700168_39	Northern blot analysis of total RNA (20 mug/lane) was performed |A5:**1MP3E3| as previously described (Lehrach et al., 1977). |A5:**2MP3E2| |A1:**1MP3E23| |A2:**1MP3E23| |A3:**1MP3E2| |A4:**1SP3E2|
				Annotation	1MP3E23 1MP3E23	1MP3E23 1MP3E23	1MP3E2 1MP3E2	1SP3E2 1SP3E2	1MP3E3 2MP3E2
				Evidence	3 3	3 3	3 3	3 3	4 3
				Focus	2 2	2 2	2 2	4 4	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
226	8515	8548831_198	Whereas only the human acrocentric chromosomes 13, 14, 15, 21, and 22 have rDNA repeats and secondary constrictions, all human chromosomes have a primary constriction at the site of the centromere. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E1
				Evidence	1	1	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
227	5634	12132659_12	Therefore, emotionally-induced sweating can enhance the release of organic substrates. |A1:**1GP1E1| |A2:**1GP2E1+| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1GP1E1	1GP2E1+	1SP3E0	1SP3E0	1SP3E1
				Evidence	2	2	1	1	2
				Focus	1	1	4	4	4
				Polarity	5	6	7	7	7
228	2907	9657992_89	After the addition of 5 mul of 0.25x Tris-borate-EDTA (TBE) containing 40% glycerol, incubated samples were run on a 6% polyacrylamide gel (79:1) in 0.25x TBE, followed by electroblotting onto a nylon membrane (Hybond-N; Amersham) and fixation by UV cross-linking. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
229	7226	10075737_178	Indeed, the kinetics of calpain activity paralleled the initiation and progressive loss of membrane integrity (Figs. 3 and 5). |A1:**1SP3E3| |A2:**1SP3E3-| |A3:**1SP2E3| |A4:**1SP3E3-| |A5:**1SP3E3+|
				Annotation	1SP3E3	1SP3E3-	1SP2E3	1SP3E3-	1SP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	6	7	7
230	658	12204687_25	HRP-2 has been shown to bind multiple molecules of heme and to mediate heme polymerization in vitro [10, 11]. |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2+|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2+
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
231	8691	8621600_27	Additional experiments are required to assess |A5:**1SP3E1| whether this region contains phosphorylation sites involved in receptor uncoupling and to identify the putative kinase participating in such regulation. |A5:**2SP1E1| |A1:**1SP3E3| |A2:**1SP1E1| |A3:**1SP3E0| |A4:**1SP3E1|
				Annotation	1SP3E3 1SP3E3	1SP1E1 1SP1E1	1SP3E0 1SP3E0	1SP3E1 1SP3E1	1SP3E1 2SP1E1
				Evidence	4 4	2 2	1 1	2 2	2 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	5 5	7 7	7 7	7 5
232	5780	11861568_153	Comparison of standardized intervals reveals variable recombination along the male chromosomes. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1SP3E3|
				Annotation	1GP3E0	1SP3E0	1SP3E3	1SP3E0	1SP3E3
				Evidence	1	1	4	1	4
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
233	9837	11526156_127	SEM images of mature (48-h) C. dubliniensis NCPF 3949 biofilms formed on PMMA. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	4	2
				Polarity	7	7	7	7	7
234	9005	11923998_4	Caregivers are encouraged to answer infant cries swiftly, consistently, and comprehensively. |A1:**1GP3E3| |A2:**1GP3E0| |A3:**1GP3E0| |A4:**1GP3E0| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E0	1GP3E0	1GP3E0	1GP3E3
				Evidence	4	1	1	1	4
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
235	6424	9390512_193	The T102C polymorphism does not change the amino acid sequence of the protein, |A1:**1SN3E0| |A2:**1SN3E0| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1GN3E2| although it is possible that it could affect the secondary structure and stability of the mRNA (Arranz et al. 1995). |A1:**2SP1E2| |A2:**1SP2E2| |A3:**2SP2E2| |A4:**2SP2E2| |A5:**2GP2E2|
				Annotation	1SN3E0 2SP1E2	1SN3E0 1SP2E2	1SN3E0 2SP2E2	1SN3E0 2SP2E2	1GN3E2 2GP2E2
				Evidence	1 3	1 3	1 3	1 3	3 3
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	1 5	1 6	1 6	1 6	1 6
236	1614	10988293_12	Furthermore, the general CaMK inhibitor, KN-93, |A5:**1GP3E2| blocks cell proliferation before S phase in both cycling cells |A3:**1SP3E0-| and those stimulated to enter the cell cycle from G0 ( ). |A3:**2SP3E0| |A1:**1SN3E2| |A2:**1SP3E2-| |A4:**1SP3E0| |A5:**2SP3E2-|
				Annotation	1SN3E2 1SN3E2 1SN3E2	1SP3E2- 1SP3E2- 1SP3E2-	1SP3E0- 1SP3E0- 2SP3E0	1SP3E0 1SP3E0 1SP3E0	1GP3E2 2SP3E2- 2SP3E2-
				Evidence	3 3 3	3 3 3	1 1 1	1 1 1	3 3 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 4 4
				Polarity	1 1 1	7 7 7	7 7 7	7 7 7	7 7 7
237	9517	12163473_174	Additionally, some proteins involved in motility and adhesion are substrates for both calpains and caspases (e.g., FAK, actin, and cortactin), |A2:**1SP3E0| and some of these proteins are also substrates of Src (for review see Tatosyan and Mizenina, 2000), |A1:**1SP3E23| whose phosphorylation is modulated by E4orf4 expression (positively and negatively for cortactin and FAK, respectively) ( Lavoie et al., 2000). |A1:**2SP3E23| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E23 1SP3E23 2SP3E23	1SP3E0 1SP3E2 1SP3E2	1SP3E2 1SP3E2 1SP3E2	1SP3E2 1SP3E2 1SP3E2	1SP3E2 1SP3E2 1SP3E2
				Evidence	3 3 3	1 3 3	3 3 3	3 3 3	3 3 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
238	2691	10618205_98	Cells were fixed with 1% (vol/vol) glutaraldehyde, stained with 0.05% acridine orange (vol/vol), and then filtrated through polycarbonate filters (Nuclepore Track-Etch membrane; 0.2-mum pore size; Corning Costar, Boston, Mass.). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
239	9315	10197540_118	Periods of acoustic stimulation of 8 volumes each alternated with rest conditions of the same duration (Figure 2, bottom). |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	2	2
				Polarity	7	7	7	7	7
240	9896	10454358_192	In mutants, we found only a slight initial depression of EPSCs |A1:**1SN3E3| and a single LTPAMPA, at 156.7 plus-or-minus 15.6% with no rebound of NMDA receptor-mediated EPSCs (105 plus-or-minus 3.3%) following 60 muM ACPD (Fig. 5b; 25 neurons, 13 mice; P < 0.01). |A1:**2SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SN3E3 2SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	2 2	2 2
				Polarity	1 7	7 7	7 7	7 7	7 7
241	4158	9727068_82	Membranes were blocked overnight at 4 degrees C in 5% dry milk. |A1:**1SN3E3| |A2:**1SN3E3| |A3:**1MP3E3| |A4:**1GP3E0| |A5:**1MP3E3|
				Annotation	1SN3E3	1SN3E3	1MP3E3	1GP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	2	1	2
				Polarity	1	1	7	7	7
242	3602	11063675_279	HAARER, B. K., A. CORBETT, Y. KWEON, A. S. PETZOLD, and P. SILVER et al., 1996 SEC3 mutations are synthetically lethal with profilin mutations and cause defects in diploid-specific bud-site selection. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**1SP3E2|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E3	1SP3E2
				Evidence	4	4	1	4	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
243	483	11713265_276	The cells were incubated for an additional 1 h to allow all conjugated dextran to be taken up into lysosomes (21). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1MP3E2| |A4:**1MP3E2| |A5:**1MP3E2|
				Annotation	1SP3E23	1SP3E23	1MP3E2	1MP3E2	1MP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
244	1973	11509657_92	For technical reasons, GFP-c-CRD ( Mr, 36,000) was used for mass spectrometry (MS), |A1:**1MP3E3| and deltaGFP-c-CRD ( Mr, 14,400), in which most of the GFP region was deleted, was used for peptide analysis and thioredoxin-dependent reduction experiments. |A1:**2MP3E3| |A2:**1MP3E3| |A3:**1MSP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 2MP3E3	1MP3E3 1MP3E3	1MSP3E3 1MSP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	6 6	2 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
245	1053	12957289_168	Conditioned media were concentrated by TCA precipitation, normalized for protein concentration, and immunoblotted with an anti-VEGF antibody. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
246	8980	12551960_21	This facilitates the correlation of cellular and molecular events with the behavioral change, as well as targeted interventions in identified brain areas at discrete phases of the use-dependent behavioral change. |A1:**1GP3E0| |A2:**1SP2E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1SP2E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	7	6	7	7	7
247	3160	11687499_101	Among these are a Wnt homologue and a homologue of Mex-3, which is required for anterior-posterior patterning in C. elegans; |A4:**1SP3E0| both, therefore, are good candidates for mRNAs involved in axis formation ( Sasakura et al. 1998a, Satou 1999). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**2SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E0 2SP3E2	1SP3E2 1SP3E2
				Evidence	3 3	3 3	3 3	1 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
248	7648	11930903_15	In addition to inhibition of prostaglandin synthesis, |A2:**1SP3E0-| |A5:**1SP3E0-| damage resulted in an increase of cyclooxygenase-2 protein expression. |A2:**2SP3E3+| |A1:**1SN3E3+| |A3:**1SP3E0| |A4:**1SN3E0+| |A5:**2SP3E0+|
				Annotation	1SN3E3+ 1SN3E3+	1SP3E0- 2SP3E3+	1SP3E0 1SP3E0	1SN3E0+ 1SN3E0+	1SP3E0- 2SP3E0+
				Evidence	4 4	1 4	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	7 7	7 7	1 1	7 7
249	5279	8789948_269	For example, the current response of the heteromeric 2/ 1 NMDA receptor channel is more than two orders of magnitude largerR than that of the homomeric 1 channel in a Xenopus oocyte expression system. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E0	1SP3E1	1SP3E0	1SP3E0	1SP3E1
				Evidence	1	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
250	8423	9560277_113	To determine whether the observed decrease in cartridge density reflected a generalized decrease in GAT-1 immunoreactivity in all GABA terminals, |A2:**1SP2E3-| |A3:**1SP2E0| |A5:**1SP3E0-| two measures were made of all GAT-1-labeled boutons. |A2:**2SP3E3| |A1:**1SP2E3| |A3:**2SP3E3| |A4:**1SP3E1-| |A5:**2SP3E3|
				Annotation	1SP2E3 1SP2E3	1SP2E3- 2SP3E3	1SP2E0 2SP3E3	1SP3E1- 1SP3E1-	1SP3E0- 2SP3E3
				Evidence	4 4	4 4	1 4	2 2	1 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	6 6	6 7	6 7	7 7	7 7
251	3382	11306348_198	Consensus sequences derived from peptides selected by mutant WW domains. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1SP3E0
				Evidence	4	4	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
252	6048	11533250_309	Wnt signaling plays a critical role in carcinogenesis (48). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E0| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E0	1SP3E2	1SP3E2
				Evidence	3	3	1	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
253	4511	11779820_94	The outcomes suggest that breaks within tracts lead to intramolecular recombination (or possibly sister chromatid conversion without exchange), giving rise to expansions and contractions, |A3:**1SP2E3| |A5:**1SP2E1| and that breaks with no remnant of repeat units are invasive into the homolog and lead to conversion. |A3:**2SN3E0| |A1:**1GP3E0| |A2:**1SP3E1| |A4:**1SP3E1| |A5:**2SN3E1|
				Annotation	1GP3E0 1GP3E0	1SP3E1 1SP3E1	1SP2E3 2SN3E0	1SP3E1 1SP3E1	1SP2E1 2SN3E1
				Evidence	1 1	2 2	4 1	2 2	2 2
				Focus	1 1	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	6 1	7 7	6 1
254	9431	12135932_7	The multiple spinal cords remain but are enclosed in a single spinal column as in the human diastematomyelia. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E1
				Evidence	1	1	1	1	2
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
255	9696	9560277_125	In the one study that did report a decrease in the density of small presumably nonpyramidal neurons in PFC layer 2 (31), |A4:**1SP1E2| the decrease appeared to be associated with the presence of affective traits ( 32). |A4:**2SP1E2-| |A1:**1GP3E2-| |A2:**1SP3E2-| |A3:**1SP2E2| |A5:**1SP3E2-|
				Annotation	1GP3E2- 1GP3E2-	1SP3E2- 1SP3E2-	1SP2E2 1SP2E2	1SP1E2 2SP1E2-	1SP3E2- 1SP3E2-
				Evidence	3 3	3 3	3 3	3 3	3 3
				Focus	1 1	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	6 6	5 5	7 7
256	4029	9268348_7	The conventional names are listed together with the new systematic names in Table I. |A1:**1GP3E3| |A2:**1GP3E3| |A4:**1GP3E2| Avidity, specificity, and MV-inhibitory property of anti-CD46 mAbs mAb |A5:**1SP3E3| a Avidity for human CD46 |A5:**2SP3E3+| b Binding to simian CD46 |A5:**3SP3E3| c Inhibition of sH binding |A5:**4SP3E3-| d nM I.1.-a (E4.3) |A5:**5SP3E3| |A1:**2SP0E0| |A2:**2SP3E3-| |A3:**1SP3E3| |A4:**2SP3E0|
				Annotation	1GP3E3 2SP0E0 2SP0E0 2SP0E0 2SP0E0 2SP0E0	1GP3E3 2SP3E3- 2SP3E3- 2SP3E3- 2SP3E3- 2SP3E3-	1SP3E3 1SP3E3 1SP3E3 1SP3E3 1SP3E3 1SP3E3	1GP3E2 2SP3E0 2SP3E0 2SP3E0 2SP3E0 2SP3E0	1SP3E3 1SP3E3 2SP3E3+ 3SP3E3 4SP3E3- 5SP3E3
				Evidence	4 1 1 1 1 1	4 4 4 4 4 4	4 4 4 4 4 4	3 1 1 1 1 1	4 4 4 4 4 4
				Focus	1 4 4 4 4 4	1 4 4 4 4 4	4 4 4 4 4 4	1 4 4 4 4 4	4 4 4 4 4 4
				Polarity	7 4 4 4 4 4	7 7 7 7 7 7	7 7 7 7 7 7	7 7 7 7 7 7	7 7 7 7 7 7
257	1636	8616896_167	(A) RNA was derived from in vitro transcribed L - Vneodelta[X/Si DNA (wild type [wt]) or L - Vneo*delta[X/Si DNA (stop codon [sc). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1SP2E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1MP3E3	1SP2E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	2	4
				Polarity	7	7	7	7	6
258	4595	9058589_164	In addition, the identification of genes already known |A5:**1SP3E1| but not described to be regulated by phenobarbital |A5:**2SN3E0| opens the possibility to study their regulation |A5:**3SP2E0| in comparison to genes whose regulations have been studied for many years (e.g., cytochromes P450). |A5:**4SP3E1| |A1:**1SP2E3| |A2:**1SP1E0| |A3:**1SP2E0| |A4:**1SN1E2|
				Annotation	1SP2E3 1SP2E3 1SP2E3 1SP2E3	1SP1E0 1SP1E0 1SP1E0 1SP1E0	1SP2E0 1SP2E0 1SP2E0 1SP2E0	1SN1E2 1SN1E2 1SN1E2 1SN1E2	1SP3E1 2SN3E0 3SP2E0 4SP3E1
				Evidence	4 4 4 4	1 1 1 1	1 1 1 1	3 3 3 3	2 1 1 2
				Focus	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4
				Polarity	6 6 6 6	5 5 5 5	6 6 6 6	3 3 3 3	7 1 6 7
259	2718	11358869_32	One FoxH1 homolog has been identified in mouse (also known as FAST2 or FoxH1a), as well as in human (FoxH1) and zebrafish ( schmalspur) (Labbe et al. 1998 Zhou ; et al. 1998 ; Pogoda et al. 2000 ; Sirotkin et al. 2000 ). |A1:**1SP2E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP2E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	6	7	7	7	7
260	4477	10464322_5	Activation of Src kinase by the latter |A5:**1GP3E0+| was also prevented by N2O3 scavenger homocysteine. |A5:**2GP3E0-| |A1:**1SN3E3| |A2:**1SP3E3| |A3:**1SP2E0| |A4:**1SP3E0|
				Annotation	1SN3E3 1SN3E3	1SP3E3 1SP3E3	1SP2E0 1SP2E0	1SP3E0 1SP3E0	1GP3E0+ 2GP3E0-
				Evidence	4 4	4 4	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	1 1	7 7	6 6	7 7	7 7
261	1740	10702487_218	The moderate numbers of S. aureus organisms in milk |A5:**1GP3E0| could explain this phenomenon |A5:**2GP2E0| by being below the threshold necessary |A5:**3GP3E0-| for the triggering of an effective inflammatory response. |A5:**4GP3E0+| |A1:**1GP1E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP3E3+|
				Annotation	1GP1E0 1GP1E0 1GP1E0 1GP1E0	1SP2E0 1SP2E0 1SP2E0 1SP2E0	1SP2E0 1SP2E0 1SP2E0 1SP2E0	1SP3E3+ 1SP3E3+ 1SP3E3+ 1SP3E3+	1GP3E0 2GP2E0 3GP3E0- 4GP3E0+
				Evidence	1 1 1 1	1 1 1 1	1 1 1 1	4 4 4 4	1 1 1 1
				Focus	1 1 1 1	4 4 4 4	4 4 4 4	4 4 4 4	1 1 1 1
				Polarity	5 5 5 5	6 6 6 6	6 6 6 6	7 7 7 7	7 6 7 7
262	666	11713294_284	Likewise, inhibition of PtdIns 3-kinase |A5:**1SP3E1-| or expression of dominant-negative Rac |A5:**2SP3E1+| prevented F(ab'')2 anti-Ig-triggered BCR-F-actin association and receptor internalization, respectively. |A5:**3SP3E1-| |A1:**1SN3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SN3E0|
				Annotation	1SN3E3 1SN3E3 1SN3E3	1SP3E3 1SP3E3 1SP3E3	1SP3E0 1SP3E0 1SP3E0	1SN3E0 1SN3E0 1SN3E0	1SP3E1- 2SP3E1+ 3SP3E1-
				Evidence	4 4 4	4 4 4	1 1 1	1 1 1	2 2 2
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	1 1 1	7 7 7	7 7 7	1 1 1	7 7 7
263	7504	9539806_37	Animals were anesthetized with an injection of isotonic MgCl2 into the hemocoel and then were pinned ventral side up in a Sylgard-coated Petri dish. |A1:**1GP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1SP3E3|
				Annotation	1GP3E3	1MP3E3	1SP3E3	1MP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	1	2	4	2	4
				Polarity	7	7	7	7	7
264	7910	10369671_207	Contractile vacuoles are specialized organelles in protists living under hypo-osmotic conditions. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
265	322	11781319_68	Numbers represent the corresponding constructs in B., untransfected cells; lane GFP, cells transfected with empty GFP vector. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP3E0	1SP3E1	1SP3E3	1SP3E0	1MP3E3
				Evidence	1	2	4	1	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
266	3496	9333244_13	Furthermore, we find that cerberus is a potent inhibitor of Wnt signalling. |A1:**1SP3E3| |A2:**1SP3E3-| |A3:**1SP2E3| |A4:**1SP3E3| |A5:**1SP3E1|
				Annotation	1SP3E3	1SP3E3-	1SP2E3	1SP3E3	1SP3E1
				Evidence	4	4	4	4	2
				Focus	4	4	4	4	4
				Polarity	7	7	6	7	7
267	2777	9753320_196	By e14.5 vascular endothelial cells seem to obliterate completely the optic cup of the Apaf1 mutant (Figure 3D). |A1:**1SP2E3| |A2:**1SP2E3| |A3:**1SP2E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP2E3	1SP2E3	1SP2E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	6	6	6	7	7
268	4810	9560277_107	Although 13 of the schizophrenic subjects were receiving antipsychotic medications at the time of death, |A5:**1GP3E1| several lines of evidence suggest that |A5:**2GP2E1| this treatment did not account for the decreased cartridge density. |A5:**3GN3E1-| |A1:**1GP3E3-| |A2:**1SN3E3-| |A3:**1SN3E3| |A4:**1SN2E3|
				Annotation	1GP3E3- 1GP3E3- 1GP3E3-	1SN3E3- 1SN3E3- 1SN3E3-	1SN3E3 1SN3E3 1SN3E3	1SN2E3 1SN2E3 1SN2E3	1GP3E1 2GP2E1 3GN3E1-
				Evidence	4 4 4	4 4 4	4 4 4	4 4 4	2 2 2
				Focus	1 1 1	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	7 7 7	1 1 1	1 1 1	2 2 2	7 6 1
269	2463	12419232_35	We reasoned that it might be possible to mimic this evolutionary history |A5:**1GP2E3| by fusing the DNA binding domains of two highly divergent LAGLIDADG homing endonucleases to generate a catalytically active chimeric endonuclease. |A5:**2SP3E3| |A1:**1SP1E3| |A2:**1SP1E1| |A3:**1SP1E0| |A4:**1SP2E3+|
				Annotation	1SP1E3 1SP1E3	1SP1E1 1SP1E1	1SP1E0 1SP1E0	1SP2E3+ 1SP2E3+	1GP2E3 2SP3E3
				Evidence	4 4	2 2	1 1	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	1 4
				Polarity	5 5	5 5	5 5	6 6	6 7
270	932	9463478_64	DNA topoisomerase II cleavage was carried out in a volume of 15 mul at 28 degrees for 6 min. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	4	2	2
				Polarity	7	7	7	7	7
271	7244	9139704_6	Why are beta1 subunits not sulfated in other alphabeta1 heterodimers? |A1:**1SN0E0| |A2:**1SN3E0| |A3:**1SN0E0| |A4:**1SN3E0| |A5:**1GN3E0|
				Annotation	1SN0E0	1SN3E0	1SN0E0	1SN3E0	1GN3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	4	1	4	1	1
272	796	10200329_25	Both issues can be effectively examined by testing first-degree relatives of schizophrenic patients. |A1:**1GP1E3| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1GP3E0| |A5:**1GP3E0|
				Annotation	1GP1E3	1SP2E0	1SP2E0	1GP3E0	1GP3E0
				Evidence	4	1	1	1	1
				Focus	1	4	4	1	1
				Polarity	5	6	6	7	7
273	2785	11238885_8	Since Dach1 mutants die shortly after birth, |A1:**1SP3E0| |A5:**1GP3E3| it remains possible that Dach1 is required for postnatal development of these structures. |A1:**2SP3E3| |A2:**1SP2E0| |A3:**1SP1E0| |A4:**1SP2E0| |A5:**2GP2E3|
				Annotation	1SP3E0 2SP3E3	1SP2E0 1SP2E0	1SP1E0 1SP1E0	1SP2E0 1SP2E0	1GP3E3 2GP2E3
				Evidence	1 4	1 1	1 1	1 1	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	6 6	5 5	6 6	7 6
274	1118	12018456_5	RESULTS: There were no prolonged wound complications, |A1:**1GN3E3| |A2:**1SN3E3| |A3:**1SN3E3| |A5:**1GN3E3| and only one positive microscopic margin was detected. |A1:**2GP3E3| |A2:**1SP3E3| |A3:**2SP1E3| |A4:**1SP3E3| |A5:**2GP3E3|
				Annotation	1GN3E3 2GP3E3	1SN3E3 1SP3E3	1SN3E3 2SP1E3	1SP3E3 1SP3E3	1GN3E3 2GP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	1 7	1 7	1 5	7 7	1 7
275	9904	9271115_212	If both LIG4 and Ku are involved in illegitimate DNA end-joining, one possible explanation of the apparent discrepancies in their mutant phenotypes could be that |A5:**1GP2E0| Ku proteins have a nonspecific DNA end protection role, |A1:**1SP1E0| |A3:**1SP1E0| |A4:**1SN2E0| whereas LIG4 might recognize a much more limited range of DNA substrates; |A5:**2SP3E0| |A1:**2SP3E0| if such specific DNA end arrangements are only rarely generated in consequence to DNA-damaging treatment with UV, MMS, or ionizing radiation, |A5:**3MP3E3| it would be expected that the contribution of LIG4 to repair of such damage is unimportant. |A5:**4GN2E0| |A1:**3SP2E0| |A2:**1SP1E1| |A3:**2SP2E0| |A4:**2SP2E0|
				Annotation	1SP1E0 1SP1E0 2SP3E0 3SP2E0 3SP2E0	1SP1E1 1SP1E1 1SP1E1 1SP1E1 1SP1E1	1SP1E0 1SP1E0 2SP2E0 2SP2E0 2SP2E0	1SN2E0 1SN2E0 2SP2E0 2SP2E0 2SP2E0	1GP2E0 2SP3E0 2SP3E0 3MP3E3 4GN2E0
				Evidence	1 1 1 1 1	2 2 2 2 2	1 1 1 1 1	1 1 1 1 1	1 1 1 4 1
				Focus	4 4 4 4 4	4 4 4 4 4	4 4 4 4 4	4 4 4 4 4	1 4 4 2 1
				Polarity	5 5 7 6 6	5 5 5 5 5	5 5 6 6 6	2 2 6 6 6	6 7 7 7 2
276	4237	10329711_65	As the photo-cross-linking reaction with M. CviBIII was almost quantitative with respect to the duplex ODN, a crude reaction mixture of 32P-labeled TCGI/TCGA(S) and M. CviBIII was subjected to proteolytic fragmentation with chymotrypsin, and the time course of the protease reaction was analyzed by denaturing PAGE (Fig. 5). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
277	1696	12464703_24	Similarly, concurrent activation of the putamen and supplementary motor area during administration of the pursuit rotor motor-skill learning test (Grafton et al. 1992, 1994 ), |A4:**1SP3E2| |A1:**1SP3E2| |A2:**1SP3E2+| |A5:**1SP3E2| would suggest that the motor circuit of the basal ganglia may be important during motor-skill learning. |A4:**2SP2E1| |A1:**2SP1E0| |A2:**2SP2E1| |A3:**1SP2E2| |A5:**2SP2E2|
				Annotation	1SP3E2 2SP1E0	1SP3E2+ 2SP2E1	1SP2E2 1SP2E2	1SP3E2 2SP2E1	1SP3E2 2SP2E2
				Evidence	3 1	3 2	3 3	3 2	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 5	7 6	6 6	7 6	7 6
278	7222	11390642_160	Cellular lysates containing 150 mug of protein were either resolved directly by SDS-PAGE (lanes 1, 2, 5, and 6) or were treated with 5 U of calf intestinal phosphatase (CIP) in the absence (lane 3) or in the presence (+ INH) of phosphatase inhibitors, including 10 mM beta-glycerophosphate and 10 mM NaF (lane 4). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP2E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP2E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	4	2
				Polarity	7	7	6	7	7
279	4435	11292757_128	Neutrophils treated with gram-negative and gram-positive sera showed DNA fragmentation in the form of a ladder pattern, |A5:**1MP3E3| further confirming the presence of an apoptotic factor in the sera of infected patients (data not shown). |A5:**2SP3E3| |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1MSP3E3| |A4:**1SP3E3|
				Annotation	1SP3E1 1SP3E1	1SP3E1 1SP3E1	1MSP3E3 1MSP3E3	1SP3E3 1SP3E3	1MP3E3 2SP3E3
				Evidence	2 2	2 2	4 4	4 4	4 4
				Focus	4 4	4 4	6 6	4 4	2 4
				Polarity	7 7	7 7	7 7	7 7	7 7
280	3662	12167350_7	We also used the basic reproduction ratio to investigate the evolution of parasite virulence in relation to the migration decisions of susceptible hosts. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	1	4	4	4	2
				Polarity	7	7	7	7	7
281	9537	12270131_15	Other loci, intron 1, and codons 243, 325, and 594, did not show a difference between cancer patients and controls. |A1:**1SN3E0| |A2:**1SN3E0| |A3:**1SP3E3| |A4:**1SN3E0| |A5:**1GN3E3|
				Annotation	1SN3E0	1SN3E0	1SP3E3	1SN3E0	1GN3E3
				Evidence	1	1	4	1	4
				Focus	4	4	4	4	1
				Polarity	1	1	7	1	1
282	936	9111038_5	In a later paper, the same authors ( ) used the transfection of cells by annexin III cDNA to demonstrate that the phosphohydrolase activity was dependent on the expression of annexin III. |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E1| |A4:**1SP3E3| |A5:**1SMP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E1	1SP3E3	1SMP3E2
				Evidence	3	3	2	4	3
				Focus	4	4	4	4	6
				Polarity	7	7	7	7	7
283	5650	9390512_112	This region was also first identified in the JHU/MIT (Pulver et al. 1995 ) genome scan. |A1:**1SP3E23| |A2:**1SP3E2| |A3:**1MSP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E23	1SP3E2	1MSP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	6	4	1
				Polarity	7	7	7	7	7
284	7178	9673225_25	The precipitated proteins were removed by centrifugation and after being washed were resuspended in buffer containing 8 M urea, 0.5% (wt/vol) CHAPS {3-[(3-cholamidopropyl)-dimethyl ammonio-1-propanesulfonate}, and 5% (vol/vol) glycerol. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
285	7106	9827799_244	At 3 days postinoculation TEV-GFP foci were visualized using a long-wavelength UV light (Blak-Ray Long Wave Length Ultraviolet Lamp, Model B 100 AP). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
286	8350	12364586_19	Identification of schizophrenia genes is particularly challenging, |A5:**1GP3E0| because the disease may encompass several entities that have not yet been defined, |A5:**2GN2E0| limiting the accuracy of schizophrenia diagnosis as a phenotypic definition. |A5:**3GP3E0| |A1:**1GP1E0| |A2:**1SN2E1| |A3:**1SN1E0| |A4:**1SN1E0|
				Annotation	1GP1E0 1GP1E0 1GP1E0	1SN2E1 1SN2E1 1SN2E1	1SN1E0 1SN1E0 1SN1E0	1SN1E0 1SN1E0 1SN1E0	1GP3E0 2GN2E0 3GP3E0
				Evidence	1 1 1	2 2 2	1 1 1	1 1 1	1 1 1
				Focus	1 1 1	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	5 5 5	2 2 2	3 3 3	3 3 3	7 2 7
287	7129	11751639_226	LEF-1 isoforms that lack the inhibitory amino-terminal domain bind chromatin more avidly and function as potent feedback inhibitors of Wnt signaling in vivo (dominant negative DN LEF-1). |A1:**1SP3E0| |A2:**1SP3E0-| |A3:**1SP2E1| |A4:**1SP2E1| |A5:**1SP3E1|
				Annotation	1SP3E0	1SP3E0-	1SP2E1	1SP2E1	1SP3E1
				Evidence	1	1	2	2	2
				Focus	4	4	4	4	4
				Polarity	7	7	6	6	7
288	3359	9390512_247	For example, Penrose 1948 put forward a series of arguments why anticipation in myotonic dystrophy might be artifactual. |A1:**1GP1E1| |A2:**1SP1E2| |A3:**1SP2E2| |A4:**1GP2E2| |A5:**1GP3E2|
				Annotation	1GP1E1	1SP1E2	1SP2E2	1GP2E2	1GP3E2
				Evidence	2	3	3	3	3
				Focus	1	4	4	1	1
				Polarity	5	5	6	6	7
289	2044	12711603_26	Research Fellow of the Japan Society for the Promotion of Science. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1GP3E3| |A4:**1GP3E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP3E0	1GP3E3	1GP3E0	1GP3E0
				Evidence	1	1	4	1	1
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
290	330	11566983_221	Infection with this clone was allowed to persist for 7 months, and then postinfection clones were recovered. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP0E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP0E0	1GP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	4	7
291	6033	12372287_282	Five-second prepulses (140mV to 50mV) were applied, followed by a constant test pulse to 0mV. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1MP3E0| |A5:**1MP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1MP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	1	1	4	2	2
				Polarity	7	7	7	7	7
292	6483	10629053_379	Expression of COUP-TF is required for efficient RARbeta induction by RA in cancer cells. |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E3	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	4	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
293	1692	12138073_5	Clinical groupings were based on the extent of joint restriction: minimal (group A), and moderate-severe (with supinatory foot deformity (group B), or with pronatory foot deformity (group C)). |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1GP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	1	1
				Polarity	7	7	7	7	7
294	3814	10973452_119	These observations indicate that although cryopreserved cells from the MACS appear to be suitable for other laboratory studies (12), |A2:**1SP2E2| |A3:**1SP2E2| |A4:**1SP3E2| the use of fresh cells may be preferable for evaluating cytokine responses in vitro. |A2:**2SP2E0| |A1:**1SP1E23| |A3:**2SP1E0| |A4:**2MP2E0| |A5:**1GP3E2|
				Annotation	1SP1E23 1SP1E23	1SP2E2 2SP2E0	1SP2E2 2SP1E0	1SP3E2 2MP2E0	1GP3E2 1GP3E2
				Evidence	3 3	3 1	3 1	3 1	3 3
				Focus	4 4	4 4	4 4	4 2	1 1
				Polarity	5 5	6 6	6 5	7 6	7 7
295	8502	12372285_126	The tyrosine phosphorylation level of Plex-A2 was reduced without NP-1, |A2:**1SP3E3-| |A4:**1SP3E0-| |A5:**1SP3E1-| suggesting that NP-1 might have a cooperative effect on Plex-A2 phosphorylation by Fyn. |A2:**2SP2E1| |A1:**1SP1E3-| |A3:**1SP2E0| |A4:**2SP2E1| |A5:**2SP2E1|
				Annotation	1SP1E3- 1SP1E3-	1SP3E3- 2SP2E1	1SP2E0 1SP2E0	1SP3E0- 2SP2E1	1SP3E1- 2SP2E1
				Evidence	4 4	4 2	1 1	1 2	2 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	7 6	6 6	7 6	7 6
296	9162	11448948_98	Cell extracts (50 mug of total cellular protein) were analyzed by SDS-PAGE, |A1:**1MP3E3| and the expression of p27 was determined by Western blotting. |A1:**2MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 2MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	2 2	2 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
297	788	10790380_113	Rv3135, a member of the PPE family of proteins, was uniquely variable. |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E3	1SP3E0	1SP3E3	1SP3E0	1GP3E0
				Evidence	4	1	4	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
298	4355	11076973_263	However, injections of the anti - Lva antibody cause severe furrowing defects (Fig 6 A). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
299	7722	9741697_133	Sphingomyelin and CPHS added separately or in combination to 1% Triton X-100 were solubilized by the detergent. |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1MP3E3	1MP3E3	1MP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	4	2	2	2	2
				Polarity	7	7	7	7	7
300	3355	10077572_20	Cytoplasmic GSH is maintained in its reduced form through the action of the ubiquitous enzyme GSH reductase, |A5:**1SP3E0| which catalyzes the reaction: GSSG + NADPH + H+ 2 GSH + NADP+. |A5:**2SP3E0+| |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0|
				Annotation	1SP3E3 1SP3E3	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 2SP3E0+
				Evidence	4 4	1 1	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
301	3350	10635333_195	We are grateful to J. Blenis (Harvard Medical School, Boston, MA) for the RSK and RSK mutant expression vectors and RSK antibodies, E. Olson (University of Texas, Dallas, TX) for the PKC expression vectors, and P. Johnson (NCI-Frederick Cancer Research and Development Program) for the mouse C/EBP construct. |A1:**1GP3E0| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1GP3E0	1SP3E3	1SP3E0	1SP3E3	1GP3E0
				Evidence	1	4	1	4	1
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
302	5003	9520407_209	Thus, the transition itself may involve the loss of one or more critically coordinated magnesium ions, believed to exist in the 8-12 turn and between the D and T loops. |A1:**1SP1E3| |A2:**1SP2E0| |A3:**1SP1E0| |A4:**1SP1E1-| |A5:**1SP3E1|
				Annotation	1SP1E3	1SP2E0	1SP1E0	1SP1E1-	1SP3E1
				Evidence	4	1	1	2	2
				Focus	4	4	4	4	4
				Polarity	5	6	5	5	7
303	5862	9660872_275	Enomoto (1996) has suggested that microtubules bind signaling factors that are released either in a controlled way under normal conditions, or globally when microtubules are disrupted. |A1:**1SP3E1| |A2:**1SP3E2| |A3:**1SP2E0| |A4:**1SP2E2| |A5:**1SP3E2|
				Annotation	1SP3E1	1SP3E2	1SP2E0	1SP2E2	1SP3E2
				Evidence	2	3	1	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	6	6	7
304	5803	12134252_1	Human herpesvirus (HHV)-6 is a beta-herpesvirus-like human cytomegalovirus (HCMV) with the potential to reactivate in immunocompromised persons. |A1:**1GP3E0| |A2:**1SP3E0+| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1GP3E0	1SP3E0+	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
305	4071	9405414_29	Probably because there is redundancy of function with other MS channels |A3:**1SP2E0| |A5:**1GP2E0-| no phenotype has yet been reported for the E. coli mscL-null mutant. |A3:**2SN3E0| |A1:**1SP2E1| |A2:**1SN3E0| |A4:**1SN2E0| |A5:**2GN3E1|
				Annotation	1SP2E1 1SP2E1	1SN3E0 1SN3E0	1SP2E0 2SN3E0	1SN2E0 1SN2E0	1GP2E0- 2GN3E1
				Evidence	2 2	1 1	1 1	1 1	1 2
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	6 6	1 1	6 1	2 2	6 1
306	8569	9054509_207	The intimate link between resistance and extent of spontaneous leaf lesions has been studied on the basis of an allelic series of 95 chemically induced mlo alleles (Habekuss and Hentrich, 1988). |A1:**1SP2E2| |A2:**1SP2E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP2E2	1SP2E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	6	6	7	7	7
307	3906	10101156_185	These thermosensitive alleles, especially dcp1-2, should be useful for the analysis of mRNA decay ( e.g., see J ACOBS ANDERSON and PARKER 1998 ). |A1:**1SP2E2| |A2:**1SP2E2| |A3:**1SP1E0| |A4:**1SP2E2| |A5:**1GP3E2|
				Annotation	1SP2E2	1SP2E2	1SP1E0	1SP2E2	1GP3E2
				Evidence	3	3	1	3	3
				Focus	4	4	4	4	1
				Polarity	6	6	5	6	7
308	1538	10391869_46	Pentoxifylline (5.5 mg/animal) was given 3 h after the toxin, and LPS was injected at 4 h. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	2	2
				Polarity	7	7	7	7	7
309	2601	12729560_305	A role of G signaling and PKC in the regulation of Cdc42 by Wnt-11 |A1:**1SP0E0| |A2:**1SP0E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP0E0	1SP0E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	4	4	7	7	7
310	2899	9463371_104	Interaction of various recombinant PDI fragments with biotinylated `scrambled'' RNase. |A1:**1SP0E0| |A2:**1SP0E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP0E0	1SP0E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	4	4	7	7	7
311	5710	10569766_71	This vector permits the expression of cloned genes containing the initial ATG codon of the signal sequence and is expressed with an appended (His)6 tail at the C terminus to facilitate purification. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E3+|
				Annotation	1SP3E0	1SP3E1	1SP3E0	1SP3E0	1SP3E3+
				Evidence	1	2	1	1	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
312	6958	12113534_5	This current study was performed to validate our earlier findings in a separate, statewide, population-based dataset of trauma victims. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E3	1GP3E3	1GP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
313	8838	12496348_6	Abnormalities in the brain's dopamine system have been postulated for both schizophrenia (SCHIZ) and bipolar disorder (BPD) ( 1-4). |A1:**1GP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1GP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
314	7581	9407054_68	The maximum levels of TNF-alpha and IL-1beta elevated in plasma following the LPS administration (1 and 5 h later, respectively) were then examined. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3+| |A5:**1MP3E3+|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3+	1MP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
315	2130	12102333_2	Mean values (M +/- SD) for the investigated parameters (on dry weight basis) were: 23.0 +/- 3.9%, 10.7 +/- 2.4% and 2.17 +/- 0.31, respectively. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1GP3E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1GP3E0	1GP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	4	1	1
				Polarity	7	7	7	7	7
316	9889	9469582_186	To confirm the HPGC cholesterol profile results, plasmas from PD 72953-treated rats were subjected to lipoprotein electrophoresis and oil red O staining |A1:**1SP3E3| |A2:**1SP2E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP2E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	6	7	7	7
317	2315	12006917_1	BACKGROUND: C-reactive protein (CRP) has been linked to cardiovascular disease and atherosclerosis. |A1:**1GP3E1| |A2:**1SP2E0| |A3:**1SP3E0| |A4:**1SP2E0| |A5:**1GP3E1|
				Annotation	1GP3E1	1SP2E0	1SP3E0	1SP2E0	1GP3E1
				Evidence	2	1	1	1	2
				Focus	1	4	4	4	1
				Polarity	7	6	7	6	7
318	9455	9362061_239	This process, termed "`constitutive-like secretion"` from ISGs, has slower kinetics than constitutive secretion from the TGN in other cell types. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E3	1SP3E1	1SP3E0	1SP3E0	1GP3E0
				Evidence	4	2	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
319	9313	12099308_6	There are numerous formulas for estimating fetal weight, and they are all error prone. |A1:**1GP0E0| |A2:**1GP1E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP0E0	1GP1E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	1	4	4	1
				Polarity	4	5	7	7	7
320	340	9560277_95	However, these laminar differences did not achieve statistical significance. |A1:**1GN3E1| |A2:**1GN3E1| |A3:**1SN3E0| |A4:**1SN2E0| |A5:**1GN3E1|
				Annotation	1GN3E1	1GN3E1	1SN3E0	1SN2E0	1GN3E1
				Evidence	2	2	1	1	2
				Focus	1	1	4	4	1
				Polarity	1	1	1	2	1
321	2333	9490721_124	HRP (5 mg/ ml) was internalized for 30 min, |A1:**1MP3E3| and the Golgi was labeled with NBD-ceramide, as described in Materials and Methods. |A1:**2MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 2MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	2 2	2 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
322	6446	10702503_54	Densitometric tracks from each lane were normalized with respect to a molecular size standard (250-bp ladder; Gibco/BRL, Gaithersburg, Md.), which was included in four lanes on every gel, and then were compared in a pairwise fashion with tracks from other lanes from the same gel or different gels. |A1:**1MP3E3| |A2:**1MSP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MSP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	6	2	2	2
				Polarity	7	7	7	7	7
323	180	9334316_288	Thus, Bru has multiple roles in development; given its role in repression of osk mRNA translation, |A2:**1SP2E1-| |A3:**1SP3E0| |A4:**1SP3E3-| |A5:**1SP3E1| we expect that Bru regulates the translation of multiple transcripts. |A2:**1SP1E0| |A1:**1SN2E3| |A3:**2SP1E0| |A4:**2SP2E0| |A5:**2SP2E0|
				Annotation	1SN2E3 1SN2E3	1SP2E1- 1SP1E0	1SP3E0 2SP1E0	1SP3E3- 2SP2E0	1SP3E1 2SP2E0
				Evidence	4 4	2 1	1 1	4 1	2 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	2 2	6 5	7 5	7 6	7 6
324	2699	11526013_78	During the first step, the molecular mass was determined from the measured m/z values for the protonated molecules. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	4	2
				Polarity	7	7	7	7	7
325	3503	9488491_278	In an effort to characterize the domains of BKV TAg required for the induction of E2F, |A4:**1SP3E3+| we used mutations in the pRb-binding and J domains to show that both of these domains are required for the induction of E2F activity. |A4:**2SP3E3| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3+| |A5:**1SP3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3+ 1SP3E3+	1SP3E3+ 2SP3E3	1SP3E3 1SP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
326	8326	8978603_322	DNA was prepared from whole blood using the Puregene kit. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	4	2
				Polarity	7	7	7	7	7
327	2036	9512515_50	Two of these ES cell clones were used to generate chimeric mice, and both successfully contributed to the germ line. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
328	6163	11682507_123	Interestingly, this genotype Ba infection was the only genotype Ba sample in the entire study. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E1|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E1
				Evidence	4	4	4	4	2
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
329	4628	9827803_115	The vessels in the cortex of the v-null embryo are markedly dilated and filled with nucleated red blood cells (M) in comparison with the wild-type cortex (L). |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E3
				Evidence	1	1	1	1	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
330	4688	9844016_20	Varying levels of gamma2S and gamma2L occur in cerebral cortex (36-39). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
331	7017	12081574_4	SHR 4 to 6 weeks of age were pre-hypertensive, 6 to 7 weeks old had mild hypertension, and 8 to 13 weeks old had severe hypertension. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E0	1GP3E1
				Evidence	4	4	4	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
332	5918	10811829_69	Neurite Outgrowth Assay Cells were fixed 24 h after transfection transfection. |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1MP3E3	1SP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	2	4	2	2
				Polarity	7	7	7	7	7
333	8988	12362329_7	The information in YPRC-PDB is updated easily and it is available to authorized users on the World Wide Web (http://yprcpdb.proteomix.org/ |A1:**1GP3E0| |A2:**1GP3E2| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1GP3E0	1GP3E2	1SP3E3	1SP3E3	1GP3E3
				Evidence	1	3	4	4	4
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
334	3508	10449458_65	The reaction was carried out in a RoboCycler Gradient 96 Temperature Cycler (Stratagene) for 60 min at 37 degrees C and then for 10 min at 65 degrees C. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	4	2	2
				Polarity	7	7	7	7	7
335	8346	10617652_12	Conceivably, medulloblastomas may recapitulate some properties of these cells |A3:**1SP1E0| and thereby undergo apoptosis upon Ras activation. |A3:**2SP3E0| |A1:**1SP1E0| |A2:**1SP2E0+| |A4:**1SP2E0| |A5:**1SP1E0|
				Annotation	1SP1E0 1SP1E0	1SP2E0+ 1SP2E0+	1SP1E0 2SP3E0	1SP2E0 1SP2E0	1SP1E0 1SP1E0
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	6 6	5 7	6 6	5 5
336	5515	11292744_211	This difference may have resulted from a more disparate geographic distribution of the latter samples, as the ticks that were used to experimentally infect the dogs probably were collected in a more constrained region of the state of New York than that from which the clinically diagnosed samples originated. |A1:**1GP1E3| |A2:**1GP2E3| |A3:**1MP2E3| |A4:**1MP2E1-| |A5:**1GP3E3|
				Annotation	1GP1E3	1GP2E3	1MP2E3	1MP2E1-	1GP3E3
				Evidence	4	4	4	2	4
				Focus	1	1	2	2	1
				Polarity	5	6	6	6	7
337	9848	9407085_1	RESULTS Comparison of Activities of the H1t and H1d Promoters in NIH3T3 Cells |A5:**1SP3E3| It was previously reported that the promoter from common somatic H1 variant H1d was considerably stronger than the H1t promoter in directing expression of the chloramphenicol acetyl transferase gene in stably transfected mouse L cells ( ). |A5:**2SP3E2| |A1:**1SP3E23| |A2:**1SP2E12| |A3:**1SP3E3| |A4:**1SP3E3|
				Annotation	1SP3E23 1SP3E23	1SP2E12 1SP2E12	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 2SP3E2
				Evidence	3 3	2 2	4 4	4 4	4 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	6 6	7 7	7 7	7 7
338	2766	11466272_125	Another distinguishing characteristic of DPG-dependent and Mn-dependent Gpms is that they differ in their optimum pH ( 4). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
339	553	8752214_140	Detection and quantitation of endogenous noggin and BMP proteins in the embryo remains problematic. |A1:**1SP0E0| |A2:**1SP0E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP0E0	1SP0E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	4	4	7	7	7
340	6780	10037791_261	Consistent with this possibility, Jemmerson et al. (1999) have obtained evidence that mouse cytochrome c does assume a different conformation early in apoptosis of a T cell hybridoma. |A1:**1SP3E3| |A2:**1SP3E2| |A3:**1SP3E3| |A4:**1SN3E2| |A5:**1SP3E2|
				Annotation	1SP3E3	1SP3E2	1SP3E3	1SN3E2	1SP3E2
				Evidence	4	3	4	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	1	7
341	7271	10588960_98	The introduction of these 'identifiers, and the subsequent induction of heteroduplex formation with the PCR product containing the mutation, |A5:**1SP3E2| results in an increased degree of mismatch between the heteroduplex strands |A5:**2SP3E2+| |A2:**1SP3E1+| which is responsible for the greatly reduced mobility of heteroduplexes on a non-denaturing polyacrylamide gel (33)(35). |A5:**3SP3E2-| |A1:**1SP3E2+| |A2:**2SP3E2-| |A3:**1SP3E2| |A4:**1SP3E0|
				Annotation	1SP3E2+ 1SP3E2+ 1SP3E2+	1SP3E1+ 1SP3E1+ 2SP3E2-	1SP3E2 1SP3E2 1SP3E2	1SP3E0 1SP3E0 1SP3E0	1SP3E2 2SP3E2+ 3SP3E2-
				Evidence	3 3 3	2 2 3	3 3 3	1 1 1	3 3 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
342	7640	10421629_23	Wnt signaling modifies Axin. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
343	431	11086989_238	Both of these steps are crucial, as evidenced by the fact that rdgC mutants and arr2(S366A) mutants |A5:**1GP3E1| both undergo rapid light-dependent retinal degeneration. |A5:**2GP3E0-| |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP2E0| |A4:**1SP3E0|
				Annotation	1SP3E0 1SP3E0	1SP3E1 1SP3E1	1SP2E0 1SP2E0	1SP3E0 1SP3E0	1GP3E1 2GP3E0-
				Evidence	1 1	2 2	1 1	1 1	2 1
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	6 6	7 7	7 7
344	2837	11325993_17	A superior marker of current or recent infection is required to clarify the clinical importance of C. pneumoniae infection in chronic diseases such as atherosclerosis. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
345	5784	12198154_5	In addition, caspase-10 can not substitute for caspase-8, as the defect in apoptosis induction observed in caspase-8-deficient cells could not be rescued by overexpression of caspase-10. |A1:**1SP1E0| |A2:**1SN3E0| |A3:**1SN3E3| |A4:**1SN3E3+| |A5:**1SN3E1|
				Annotation	1SP1E0	1SN3E0	1SN3E3	1SN3E3+	1SN3E1
				Evidence	1	1	4	4	2
				Focus	4	4	4	4	4
				Polarity	5	1	1	1	1
346	7382	11841944_480	The identities of the coupled products were confirmed by electrospray mass spectrometry. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	4	4	4	2
				Polarity	7	7	7	7	7
347	1128	10722617_100	After washing in TBS-0.1% Tween 20, the bound antibodies were reacted with alkaline phosphatase-conjugated secondary antibodies (1/5,000 in TBS-0.1% Tween 20-3% neonatal goat serum), and membranes were developed with the chemiluminescence substrate CDP-Star (Boehringer). |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1MP3E3	1SP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	2	4	2	2
				Polarity	7	7	7	7	7
348	9234	10669745_255	In good agreement with previous results (32), |A5:**1GP3E2| |A4:**1SP3E2| we found that the overexpression of the wild-type protein, |A5:**2GP3E3+| |A3:**1SP3E2| but not of Vav (delta1-66), |A5:**3GN3E3| |A3:**1SN3E0| induced a high basal activity of NF-AT in nonstimulated cells (Fig. 6A). |A5:**4SP3E3+| |A1:**1SP3E3+| |A2:**1SP3E23+| |A3:**1SP3E3| |A4:**2SP3E3+|
				Annotation	1SP3E3+ 1SP3E3+ 1SP3E3+ 1SP3E3+	1SP3E23+ 1SP3E23+ 1SP3E23+ 1SP3E23+	1SP3E2 1SP3E2 1SN3E0 1SP3E3	1SP3E2 2SP3E3+ 2SP3E3+ 2SP3E3+	1GP3E2 2GP3E3+ 3GN3E3 4SP3E3+
				Evidence	4 4 4 4	3 3 3 3	3 3 1 4	3 4 4 4	3 4 4 4
				Focus	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4	1 1 1 4
				Polarity	7 7 7 7	7 7 7 7	7 7 1 7	7 7 7 7	7 7 1 7
349	6356	9560277_72	Serial sections were collected beginning at the tissue Epon tissue-Epon interface. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP3E0	1GP3E3
				Evidence	4	4	4	1	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
350	941	11960809_4	Subjects performed blocks of randomly mixed prosaccades and antisaccades. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1SP3E3-| |A4:**1GP3E0| |A5:**1GP3E3|
				Annotation	1GP3E0	1GP3E0	1SP3E3-	1GP3E0	1GP3E3
				Evidence	1	1	4	1	4
				Focus	1	1	4	1	1
				Polarity	7	7	7	7	7
351	7267	11069105_48	Phosphorylation of His6-PFK-2 did not affect FBPase-2 activity (see Supplementary material). |A1:**1SN3E0| |A2:**1SN3E1| |A3:**1SN3E3| |A4:**1SN3E3| |A5:**1SN3E3|
				Annotation	1SN3E0	1SN3E1	1SN3E3	1SN3E3	1SN3E3
				Evidence	1	2	4	4	4
				Focus	4	4	4	4	4
				Polarity	1	1	1	1	1
352	9148	9618506_133	hsREV3p does not however appear to be involved in normal DNA replication, |A3:**1SN3E3| |A5:**1SN3E3| because the MSU-1.2-10A-42 cells that express high levels of hsREV3 antisense RNA in the absence of tet were found to replicate at the normal rate (data not shown). |A3:**2SP3E3| |A1:**1SP3E1| |A2:**1SN3E1| |A4:**1SN2E3+| |A5:**2SP3E3|
				Annotation	1SP3E1 1SP3E1	1SN3E1 1SN3E1	1SN3E3 2SP3E3	1SN2E3+ 1SN2E3+	1SN3E3 2SP3E3
				Evidence	2 2	2 2	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	1 1	1 7	2 2	1 7
353	2480	11015381_56	When the dogs were euthanized at the conclusion of the study, additional tissues, including blood, heart, spleen, kidneys, bladder, cerebrospinal fluid, and joints, were also examined. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
354	7430	8626420_59	Total activated p85/PI 3-K activity = total activated PI 3-K activity - total activated PI 3-K activity. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E3	1SP3E3	1GP3E0
				Evidence	1	1	4	4	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
355	5217	10618080_136	An incidental finding with potential usefulness was also noted during the course of this work. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP2E3| |A5:**1GP2E3|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP2E3	1GP2E3
				Evidence	4	4	4	4	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	6	6
356	5378	11902611_8	Five subjects showed enamel demineralization on a total of 30 teeth at the time of de-bonding. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1GP3E0| |A5:**1GP3E3-|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1GP3E0	1GP3E3-
				Evidence	4	4	4	1	4
				Focus	4	4	4	1	1
				Polarity	7	7	7	7	7
357	1854	11102376_354	This is consistent with the kinase activity of Trc being functionally important for bristle morphogenesis. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E1	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	2	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
358	226	12183451_12	Unlike most conventional chemotherapeutic drugs, ALP does not target the DNA but acts at the level of cell membranes. |A1:**1SN3E0| |A2:**1SN3E0| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1GN3E0|
				Annotation	1SN3E0	1SN3E0	1SN3E0	1SN3E0	1GN3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	1	1	1	1	1
359	4586	7608173_59	However, the cell surface expression of transferrin receptor was reduced by 44%. |A1:**1SP3E3| |A2:**1SP3E3-| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1GP3E3-|
				Annotation	1SP3E3	1SP3E3-	1SP3E3	1SP3E0	1GP3E3-
				Evidence	4	4	4	1	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
360	7990	11894887_3	Until the late 1960s, developmental texts reassured parents and teachers that homosexual behavior among adolescents was transitory and quite normal. |A1:**1GP3E0| |A2:**1GP3E1| |A3:**1SP3E0| |A4:**1GP3E0| |A5:**1GP3E1|
				Annotation	1GP3E0	1GP3E1	1SP3E0	1GP3E0	1GP3E1
				Evidence	1	2	1	1	2
				Focus	1	1	4	1	1
				Polarity	7	7	7	7	7
361	9683	11905996_7	These data indicate that mechanisms relating to AP-1 transcription factor complexes underlying nerve growth factor-mediated enhancement of cholinergic gene expression may differ from those required for morphological differentiation. |A1:**1SP1E3| |A2:**1SP2E3| |A3:**1SP1E3| |A4:**1SP3E3| |A5:**1SP3E1|
				Annotation	1SP1E3	1SP2E3	1SP1E3	1SP3E3	1SP3E1
				Evidence	4	4	4	4	2
				Focus	4	4	4	4	4
				Polarity	5	6	5	7	7
362	61	11326002_39	Protease sequences have been submitted to the GenBank database with the accession numbers AF247007 to AF247038. |A1:**1GP3E1| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1GP3E1	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	2	4	4	4	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
363	3460	12048123_4	ApoE*3 Leiden mice developed marked hypercholesterolaemia, and early Type I 'fatty streak' lesions, |A1:**1SP3E3| following consumption of an atherogenic diet high in saturated fat and cholesterol, and containing sodium cholate, for up to 4 weeks. |A1:**2SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SMP3E3|
				Annotation	1SP3E3 2SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SMP3E3 1SMP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	6 6
				Polarity	7 7	7 7	7 7	7 7	7 7
364	2862	9614070_287	FPLC data demonstrated that the reaction of cisplatin with rHA (1:1, 1 mM) |A5:**1SP3E3| was accompanied by a decrease in the amount of monomeric albumin to an average of 58%, |A2:**1SP3E3-| |A1:**1SP3E3-| |A4:**1MP3E3-| |A5:**2SP3E3-| by an increase of dimer content, |A2:**1SP3E0+| and appearance of higher molecular mass polymers (Fig. 7 B). |A2:**1SP3E3| |A1:**2SP3E3+| |A3:**1SP3E3| |A4:**2SP3E3+| |A5:**3SP3E3+|
				Annotation	1SP3E3- 1SP3E3- 2SP3E3+ 2SP3E3+	1SP3E3- 1SP3E3- 1SP3E0+ 1SP3E3	1SP3E3 1SP3E3 1SP3E3 1SP3E3	1MP3E3- 1MP3E3- 2SP3E3+ 2SP3E3+	1SP3E3 2SP3E3- 3SP3E3+ 3SP3E3+
				Evidence	4 4 4 4	4 4 1 4	4 4 4 4	4 4 4 4	4 4 4 4
				Focus	4 4 4 4	4 4 4 4	4 4 4 4	2 2 4 4	4 4 4 4
				Polarity	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7
365	7493	10671457_171	At least 19 cellulosomal polypeptides have been cloned and sequenced (2). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP2E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP2E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	6	7	7
366	2433	9835626_215	The ability of TIMP-1 to inhibit apoptosis in an MMP-independent manner is consistent with |A5:**1SP3E2| observations of growth promotion by TIMPs in a variety of cell types ( 13). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2-| |A5:**2SP3E2+|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2- 1SP3E2-	1SP3E2 2SP3E2+
				Evidence	3 3	3 3	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
367	5919	11038179_17	One current model for nuclear transport is that nuclear carriers move through the NPC by repeated association - dissociation reactions with NPC proteins, a process that has been called "`facilitated diffusion"` diffusion" |A5:**1SP3E2| and that appears not to require an energy source (Kose et al. 1997 ; Ribbeck et al. 1998 ; Schwoebel et al. 1998 ; Englmeier et al. 1999 ; Talcott and Moore 1999 ). |A5:**2SN3E2| |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 2SN3E2
				Evidence	3 3	3 3	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 1
368	5074	12361201_4	Serum levels of tissue type plasminogen activator (tPA) activity, plasminogen activator inhibitor-I (PAI-1) activity, tPA antigen, PAI-I antigen, FVII, FX, and fibrinogen were assayed after both treatments. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
369	2518	12359347_1	Bromodichloromethane (BDCM) and bromoform (TBM) have been demonstrated to be colon carcinogens in male and female F344/N rats following administration by corn oil gavage. |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E1|
				Annotation	1SP3E1	1SP3E1	1SP3E3	1SP3E3	1MP3E1
				Evidence	2	2	4	4	2
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
370	6819	9580622_172	Despite clear evidence that mibefradil is effective in the treatment of hypertension and stable angina pectoris and the fact that it is devoid of negative inotropic effects, |A5:**1SP3E1| results of a limited number of studies to date that have examined this compound in the setting of heart failure are somewhat inconsistent. |A5:**2SP1E1| |A1:**1GP2E1| |A2:**1SP1E1| |A3:**1MP1E1| |A4:**1MP1E1|
				Annotation	1GP2E1 1GP2E1	1SP1E1 1SP1E1	1MP1E1 1MP1E1	1MP1E1 1MP1E1	1SP3E1 2SP1E1
				Evidence	2 2	2 2	2 2	2 2	2 2
				Focus	1 1	4 4	2 2	2 2	4 4
				Polarity	6 6	5 5	5 5	5 5	7 5
371	9061	10747966_58	Ba2+ is distinguished from angiotensin II and DMPP by not stimulating phospholipase C activity |A2:**1SP3E0-| |A3:**1SN3E0| |A5:**1SN3E2| and an increase in Ins(1,4,5)P3 in chromaffin cells ( , ) |A2:**2SP3E2+| |A1:**1SP3E2+| |A4:**1SN3E3+| |A5:**2SP3E2+| In summary, the characteristics of the rapid movement of PH-GFP to and from the plasma membrane upon stimulation of the cells supports the conclusion that the probe binds to the plasma membrane pool of PtdIns-4,5-P2. |A2:**3SP3E1| |A1:**2SP3E1| |A3:**2SP3E3| |A4:**2SP3E3| |A5:**3SP3E1|
				Annotation	1SP3E2+ 1SP3E2+ 2SP3E1	1SP3E0- 2SP3E2+ 3SP3E1	1SN3E0 2SP3E3 2SP3E3	1SN3E3+ 1SN3E3+ 2SP3E3	1SN3E2 2SP3E2+ 3SP3E1
				Evidence	3 3 2	1 3 2	1 4 4	4 4 4	3 3 2
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	7 7 7	1 7 7	1 1 7	1 7 7
372	1317	9390512_151	Another design, the Transmission Disequilibrium Test (TDT; Terwilliger and Ott 1992 ; Spielman et al. 1993 ), |A4:**1SP3E2| tests the transmission of a particular allele from a parent to the affected individual using the other untransmitted allele from the parent as the control. |A4:**2SP3E0| |A1:**1MP3E2| |A2:**1SP3E2| |A3:**1SP3E0| |A5:**1MP3E2|
				Annotation	1MP3E2 1MP3E2	1SP3E2 1SP3E2	1SP3E0 1SP3E0	1SP3E2 2SP3E0	1MP3E2 1MP3E2
				Evidence	3 3	3 3	1 1	3 1	3 3
				Focus	2 2	4 4	4 4	4 4	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
373	5525	9768758_281	In the current model, 79.8% of the H2-M residues have highly favored angles, while 1.6% (5 residues) have disallowed angles. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
374	8892	12136945_6	The presented results suggest that urine neopterin levels are related to the activation of T cells in malignant lymphoma. |A1:**1SP3E3| |A2:**1SP3E3+| |A3:**1SP2E3| |A4:**1SP2E1| |A5:**1GP2E3|
				Annotation	1SP3E3	1SP3E3+	1SP2E3	1SP2E1	1GP2E3
				Evidence	4	4	4	2	4
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	6
375	1362	9573199_301	Results reported in the early literature of Middlebrook and Cohn suggest that INH resistance in M. tuberculosis can occur via metabolic defects that may be similar to the ndh defects found in M. smegmatis (26). |A1:**1SP1E2| |A2:**1SP2E2| |A3:**1SP1E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP1E2	1SP2E2	1SP1E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	5	6	5	7	7
376	1763	11371351_82	Activation by some mammalian HSPs may even involve TLRs (Ohashi et al., 2000). |A1:**1SP1E2| |A2:**1SP2E2+| |A3:**1SP1E2| |A4:**1SP2E2| |A5:**1GP2E2|
				Annotation	1SP1E2	1SP2E2+	1SP1E2	1SP2E2	1GP2E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	5	6	5	6	6
377	3414	9742132_89	Transcripts of the appropriate length were eluted from polyacrylamide urea gel slices as previously described (33). |A1:**1SP3E23| |A2:**1MP3E23| |A3:**1SP3E3| |A4:**1MP3E2| |A5:**1MP3E2|
				Annotation	1SP3E23	1MP3E23	1SP3E3	1MP3E2	1MP3E2
				Evidence	3	3	4	3	3
				Focus	4	2	4	2	2
				Polarity	7	7	7	7	7
378	3740	11591709_31	Whether CysLT2R might also couple to the Gi/o class in certain tissues in unknown. |A1:**1SP0E0| |A2:**1SN3E0| |A3:**1SP1E0| |A4:**1SP0E0| |A5:**1GP0E0|
				Annotation	1SP0E0	1SN3E0	1SP1E0	1SP0E0	1GP0E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	4	1	5	4	4
379	1303	9560277_19	Consequently, alterations in chandelier neurons in schizophrenia could account, at least in part, for the functional abnormalities observed in the PFC and interconnected brain regions in schizophrenia. |A1:**1SP2E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP3E0|
				Annotation	1SP2E0	1SP2E0	1SP2E0	1SP2E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	6	6	6	6	7
380	9284	10983980_13	These cell type-specific proteins bind to pre-mRNAs at discrete sites and activate (Tra) |A5:**1SP3E2+| |A2:**1SP3E1+| or repress (PSI and Sxl) splice sites |A5:**2SP3E-| by either recruiting splicing factors to the proper splice site (Lynch and Maniatis 1996 ) |A5:**3SP3E2| or blocking basal splicing factors from selecting the default splice site ( Siebel et al. 1992 ; Valcarcel et al. 1993 ). |A5:**4SP3E2-| |A1:**1SP3E2| |A2:**2SP3E2-| |A3:**1SP3E2| |A4:**1SP3E2|
				Annotation	1SP3E2 1SP3E2 1SP3E2 1SP3E2	1SP3E1+ 2SP3E2- 2SP3E2- 2SP3E2-	1SP3E2 1SP3E2 1SP3E2 1SP3E2	1SP3E2 1SP3E2 1SP3E2 1SP3E2	1SP3E2+ 3SP3E2 3SP3E2 4SP3E2-
				Evidence	3 3 3 3	2 3 3 3	3 3 3 3	3 3 3 3	3 3 3 3
				Focus	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4
				Polarity	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7
381	3318	7673177_42	Our results show that cAMP in combination with insulin stimulates the activity and phosphorylation of p70 |A5:**1SP3E3+| as demonstrated by immune complex kinase and mobility shift assays. |A5:**2MP3E3| |A1:**1MSP3E3+| |A2:**1SP3E3+| |A3:**1MSP3E3| |A4:**1SP3E3+|
				Annotation	1MSP3E3+ 1MSP3E3+	1SP3E3+ 1SP3E3+	1MSP3E3 1MSP3E3	1SP3E3+ 1SP3E3+	1SP3E3+ 2MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	6 6	4 4	6 6	4 4	4 2
				Polarity	7 7	7 7	7 7	7 7	7 7
382	8724	10523671_278	The resulting GSTG4ADp-Gal80p complex was washed and subsequently incubated in the presence or absence of galactose and ATP at 4 degrees C for 2 h with whole-cell extract of Gly-Lac-grown cells of Sc817 (gal4delta gal80delta gal3delta) or Sc817 carrying pMEGA3-delta4delta80 ( GAL3). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
383	8187	9880523_156	The peak of p38 MAKP activity was increased by 3.1 plus-or-minus 0.5- and 3.8 plus-or-minus 0.4-fold over the basal level in the presence of 100 and 300 ng/ml TL1, respectively. |A1:**1SP3E3+| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3+| |A5:**1MP3E3+|
				Annotation	1SP3E3+	1SP3E3	1SP3E3	1SP3E3+	1MP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
384	3898	9576760_121	The recovered IgG/+ANX fraction accounted for 2-6% of the total IgG from patients, but less than 0.01% of that from the controls. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A4:**1SP3E3-| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP2E3	1SP3E3-	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	6	7	7
385	2202	11573002_16	The causes of schizophrenia are not known, |A1:**1GN0E0| |A3:**1SN3E0| |A5:**1GN3E2| but it is increasingly considered a neurodevelopmental disorder ( 2, 3). |A1:**2GP3E2| |A2:**1SN3E2| |A3:**2SP3E2| |A4:**1SN3E2+| |A5:**2GP2E2|
				Annotation	1GN0E0 2GP3E2	1SN3E2 1SN3E2	1SN3E0 2SP3E2	1SN3E2+ 1SN3E2+	1GN3E2 2GP2E2
				Evidence	1 3	3 3	1 3	3 3	3 3
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	4 7	1 1	1 7	1 1	1 6
386	7856	12208047_8	Expression of all five feIFN-alpha subtypes in Chinese hamster ovary (CHO) cells was confirmed by Western blot analysis, |A1:**1MP3E3| and all resulting proteins were glycosylated. |A1:**2MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 2MP3E3	1MP3E3 1MP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	4 4	4 4	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
387	628	9684747_154	When 18:1 c was present at sn -2, both enzymes derived >95% of acyl groups from sn -2. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E0
				Evidence	4	4	4	4	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
388	4241	12460988_197	In this paper, we demonstrate that the G-domain of atToc159 mediates and likely regulates chloroplast targeting by GTP binding and hydrolysis. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP2E3	1SP2E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	7
389	8132	9230313_89	In addition, a cDNA clone representing a chicken homolog was isolated, and its predicted amino acid sequence was 66% identical to mAxin (Figure 3a). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MSP3E3| |A4:**1SP2E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1MSP3E3	1SP2E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	6	4	1
				Polarity	7	7	7	6	7
390	1700	9716414_73	Development of maxillary incisors and all mandibular teeth was found to be initiated |A5:**1GP3E3+| but arrested at the bud stage, |A5:**2SP3E3-| whereas maxillary molar tooth germs were present at the correct stage in all of the embryos examined (Fig. 3). |A5:**3SP3E3| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3|
				Annotation	1SP3E3 1SP3E3 1SP3E3	1SP3E3 1SP3E3 1SP3E3	1SP3E3 1SP3E3 1SP3E3	1SP3E3 1SP3E3 1SP3E3	1GP3E3+ 2SP3E3- 3SP3E3
				Evidence	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 4 4
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
391	4128	9797273_67	Immulon II microplates (Dynatech Laboratories, McLean, Va.) were coated with 100 ng of phage Q38. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
392	7366	11483515_259	The PP2A AC heterodimer dephosphorylates APC and axin in vitro, |A2:**1SP3E0-| |A3:**1SP3E0| |A5:**1SP3E2-| and these findings also led to the suggestion that PP2A could activate Wnt signaling ( Willert et al., 1999; Ikeda et al., 2000). |A1:**1SP3E2| |A2:**2SP2E2+| |A3:**2SP2E2| |A4:**1SP2E2| |A5:**2SP2E2|
				Annotation	1SP3E2 1SP3E2	1SP3E0- 2SP2E2+	1SP3E0 2SP2E2	1SP2E2 1SP2E2	1SP3E2- 2SP2E2
				Evidence	3 3	1 3	1 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 6	7 6	6 6	7 6
393	7	9230313_188	The observation that the major Axin mRNA is disrupted in two different alleles |A5:**1SP3E1-| that cause axial duplications |A5:**2SP3E0+| suggested that the normal gene product plays a negative regulatory role at some step in axis formation. |A5:**3SP2E0| |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3-|
				Annotation	1SP3E1 1SP3E1 1SP3E1	1SP3E1 1SP3E1 1SP3E1	1SP3E3 1SP3E3 1SP3E3	1SP3E3- 1SP3E3- 1SP3E3-	1SP3E1- 2SP3E0+ 3SP2E0
				Evidence	2 2 2	2 2 2	4 4 4	4 4 4	2 1 1
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 6
394	453	10958697_328	At 24 h after transfection, the confluent cultures were either incubated in GM for 1 further day (GM) or shifted to DM for 1 day (DM1) or 2 days (DM2). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
395	281	11792723_172	Excluding unincorporated [1,1-3H]hexadecanol, it is evident that the myelin fraction contained less than 10% of net lipid incorporated radioactivity between 30 and 240 min, and less than 3% at 240 min. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MSP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1MP3E3	1MSP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	2	6
				Polarity	7	7	7	7	7
396	4936	12138207_254	Because many of the cell cycle genes whose transient expression is diminished in the presence of Wnt |A5:**1SP3E2-| are known to be regulated by E2F (25), |A5:**2SP3E2| |A3:**1SP2E2-| |A4:**1SP2E2-| we hypothesized that E2F activity is reduced in Wnt-expressing cells. |A5:**3SP2E3-| |A1:**1SP2E23| |A2:**1SP2E23-| |A3:**2SP1E3-| |A4:**2SP1E3-|
				Annotation	1SP2E23 1SP2E23 1SP2E23	1SP2E23- 1SP2E23- 1SP2E23-	1SP2E2- 1SP2E2- 2SP1E3-	1SP2E2- 1SP2E2- 2SP1E3-	1SP3E2- 2SP3E2 3SP2E3-
				Evidence	3 3 3	3 3 3	3 3 4	3 3 4	3 3 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	6 6 6	6 6 6	6 6 5	6 6 5	7 7 6
397	5741	10653722_90	The lipase activity of lactococcal colonies was determined qualitatively by use of an agar plate assay medium containing 1% Tributyrin (Sigma) as a substrate and with nisin at 0.5 mug/ml for JIM7048 and JIM7022. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MSP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MSP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	6	2	2
				Polarity	7	7	7	7	7
398	8552	11182318_363	The solution was stirred for 72 h, extracted with 25 ml ether, and washed with 2x5 ml ice-cold H2O followed by 2x5 ml saturated NaCl salt solution. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
399	5156	11698393_11	B, Southern blot analysis of the wild type MAT2 loci. |A1:**1MP3E0| |A2:**1MP3E0| |A3:**1MSP3E0| |A4:**1MP3E0| |A5:**1MP3E3|
				Annotation	1MP3E0	1MP3E0	1MSP3E0	1MP3E0	1MP3E3
				Evidence	1	1	1	1	4
				Focus	2	2	6	2	2
				Polarity	7	7	7	7	7
400	9347	9802902_257	One molecule that has been shown to a play a role in ARF6 cytoskeletal remodeling is POR1. |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP1E0| |A5:**1GP3E1|
				Annotation	1SP3E1	1SP3E1	1SP3E0	1SP1E0	1GP3E1
				Evidence	2	2	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	5	7
401	6056	11086011_71	Based on prior analysis of other mal mutants |A5:**1GP3E1| we estimate that presence of mal25-1 |A5:**2GP2E3| leads to an 400-fold increase in minichromosome loss (Fleig et al. 1996 ; 1996; Beinhauer et al. 1997 ). |A5:**3GP3E2+| |A1:**1SP3E23+| |A2:**1SP3E23+| |A3:**1SP3E2| |A4:**1SP3E2|
				Annotation	1SP3E23+ 1SP3E23+ 1SP3E23+	1SP3E23+ 1SP3E23+ 1SP3E23+	1SP3E2 1SP3E2 1SP3E2	1SP3E2 1SP3E2 1SP3E2	1GP3E1 2GP2E3 3GP3E2+
				Evidence	3 3 3	3 3 3	3 3 3	3 3 3	2 4 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 6 7
402	3653	10052460_216	Since the three - amino acid insertion does not alter the way in which the homeodomain binds DNA (Wolberger et al., 1991), |A5:**1SN3E2| |A1:**1SN3E2| |A2:**1SN3E2| |A3:**1SN3E2| |A4:**1SN3E2| the insertion may have originated as a benign mutation |A5:**2SP2E0| that only later acquired the function of mediating interactions with other homeodomain proteins. |A5:**3SP3E0| |A1:**2SP1E0| |A2:**2SP2E0| |A3:**2SP1E0| |A4:**2SP2E0|
				Annotation	1SN3E2 2SP1E0 2SP1E0	1SN3E2 2SP2E0 2SP2E0	1SN3E2 2SP1E0 2SP1E0	1SN3E2 2SP2E0 2SP2E0	1SN3E2 2SP2E0 3SP3E0
				Evidence	3 1 1	3 1 1	3 1 1	3 1 1	3 1 1
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	1 5 5	1 6 6	1 5 5	1 6 6	1 6 7
403	1850	10978286_313	Lack of a genetic interaction suggests that these genes may act in separate pathways to regulate the death process. |A1:**1SP1E0| |A2:**1SP2E1| |A3:**1SP2E0| |A4:**1SP2E1| |A5:**1SP1E0|
				Annotation	1SP1E0	1SP2E1	1SP2E0	1SP2E1	1SP1E0
				Evidence	1	2	1	2	1
				Focus	4	4	4	4	4
				Polarity	5	6	6	6	5
404	713	11483581_17	In the present study, we examined the conditions for identifying the genome of origin for a specific genomic sequence, using the genomic signature concept. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
405	4691	10788396_110	Also, six clones from the filter biofilm and one clone for each APS reductase-positive strain were sequenced using the facilities of The Biotechnology Center of the University of Illinois. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP2E0| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP2E0	1MP3E3	1MP3E3
				Evidence	4	4	1	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	6	7	7
406	1472	10862613_42	H2O2 is known to damage both DNA and protein via reactive oxygen species. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
407	5934	9727009_53	The adenovirus Addl312 designated AdCNTL was used to control for viral infection (kindly provided by T. Shenk) (33). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
408	3708	9390512_26	Mendelian diseases follow very specific patterns of inheritance in families (recessive, dominant, or X-linked). |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
409	3327	10882667_122	These sera from B. microti-infected patients did not react with EK-rP44-2hv antigen (OD405 < 0.139). |A1:**1SN3E1| |A2:**1SN3E3| |A3:**1SN3E3| |A4:**1SN3E0| |A5:**1SN3E3|
				Annotation	1SN3E1	1SN3E3	1SN3E3	1SN3E0	1SN3E3
				Evidence	2	4	4	1	4
				Focus	4	4	4	4	4
				Polarity	1	1	1	1	1
410	1984	8557638_2	This conclusion is based on the following observations: |A5:**1GP3E1| 1) IL-1beta and IFN independently activate ERK1/ERK2 and increase NOS2 mRNA abundance in cardiac myocytes; |A5:**2SP3E1+| |A2:**1SP3E1+| |A3:**1SP3E3+| |A4:**1SP3E3+| 2) IL-1beta but not IFN activates ERK1/ERK2 and increases NOS2 mRNA levels in CMEC; |A5:**3SN3E1+| |A1:**1SP3E1+| |A2:**2SN3E1+| |A3:**2SN3E0+| |A4:**2SN3E0+| 3) inhibition of IFN - and IL-1beta-linked signaling proteins |A5:**4SP3E1-| leading to activation of ERK1/ERK2 in cardiac myocytes (i.e. PKCs and Ras) |A5:**5SP3E1+| |A2:**3SN3E1+| |A3:**3SP3E0+| |A4:**3SP3E0+| also inhibited IFN - and IL-1beta-induced NOS2 expression in these cells; |A5:**6SP3E1-| |A1:**2SN3E1+| |A2:**4SP3E1-| |A3:**4SP3E0-| |A4:**4SP3E0-| 4) nonreceptor-mediated activation of ERK2, induced by the phosphoserine protein phosphatase inhibitor okadaic acid, induced NOS2 expression in CMEC; |A5:**7SP3E1+| |A1:**3SP3E1+| and |A3:**5SP3E0+| |A4:**5SP3E0+| 5) inhibition of IL-1beta-induced activation of MEK and ERK1/ERK2 in CMEC by PD 98059 |A1:**4SN3E1+| also suppressed NOS2 induction in these cells. |A5:**8SP3E1-| |A1:**5SN3E1| |A2:**5SP3E1-| |A3:**6SP3E0-| |A4:**6SP3E0-|
				Annotation	1SP3E1+ 1SP3E1+ 1SP3E1+ 2SN3E1+ 2SN3E1+ 2SN3E1+ 3SP3E1+ 4SN3E1+ 4SN3E1+ 5SN3E1	1SP3E1+ 1SP3E1+ 2SN3E1+ 3SN3E1+ 3SN3E1+ 4SP3E1- 5SP3E1- 5SP3E1- 5SP3E1- 5SP3E1-	1SP3E3+ 1SP3E3+ 2SN3E0+ 3SP3E0+ 3SP3E0+ 4SP3E0- 5SP3E0+ 5SP3E0+ 6SP3E0- 6SP3E0-	1SP3E3+ 1SP3E3+ 2SN3E0+ 3SP3E0+ 3SP3E0+ 4SP3E0- 5SP3E0+ 5SP3E0+ 6SP3E0- 6SP3E0-	1GP3E1 2SP3E1+ 3SN3E1+ 4SP3E1- 5SP3E1+ 6SP3E1- 7SP3E1+ 8SP3E1- 8SP3E1- 8SP3E1-
				Evidence	2 2 2 2 2 2 2 2 2 2	2 2 2 2 2 2 2 2 2 2	4 4 1 1 1 1 1 1 1 1	4 4 1 1 1 1 1 1 1 1	2 2 2 2 2 2 2 2 2 2
				Focus	4 4 4 4 4 4 4 4 4 4	4 4 4 4 4 4 4 4 4 4	4 4 4 4 4 4 4 4 4 4	4 4 4 4 4 4 4 4 4 4	1 4 4 4 4 4 4 4 4 4
				Polarity	7 7 7 1 1 1 7 1 1 1	7 7 1 1 1 7 7 7 7 7	7 7 1 7 7 7 7 7 7 7	7 7 1 7 7 7 7 7 7 7	7 7 1 7 7 7 7 7 7 7
411	7330	10611247_42	For luciferase assays and stimulation of 293, the cells were plated at 105/35-mm-diameter dish 24 h prior to transfection. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
412	4854	7706290_41	The initiation of disulfide bond formation coincided with the removal of the DTT during dialysis (see Fig. 3). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
413	6857	9651682_17	If one ablates P7.p later on, however, P8.p has an epidermal fate [5, 6]. |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
414	3583	8663305_77	Open circles, sodium acetate; closed circles, Tris maleate; open squares, NaHepes; closed squares, Tris-HCl. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
415	8884	11358691_168	A plasmid of 4000 bp was isolated from transformed E. coli XL1-Blue cells grown on LBcam and named pGSVII. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1SP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	2	4	2
				Polarity	7	7	7	7	7
416	7549	10781541_31	The site of Tn 5 insertion was determined by constructing a plasmid library of the transposon insertion mutant, followed by screening the library for clones resistant to kanamycin kanamycin. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MSP3E3| |A4:**1MP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MSP3E3	1MP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	6	2	2
				Polarity	7	7	7	7	7
417	9817	12055200_217	In addition, the Wnt co-receptors LRP5 and LRP6 may mediate the Wnt10b signal |A5:**1SP2E0| because both of these genes are expressed in 3T3-L1 preadipocytes and stromal vascular cells. |A5:**2SP3E0| |A1:**1SP1E3| |A2:**1SP2E1| |A3:**1SP3E0| |A4:**1SP2E0|
				Annotation	1SP1E3 1SP1E3	1SP2E1 1SP2E1	1SP3E0 1SP3E0	1SP2E0 1SP2E0	1SP2E0 2SP3E0
				Evidence	4 4	2 2	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	6 6	7 7	6 6	6 7
418	3957	9813087_66	The Cl channel blocker diphenylamine-2-carboxylic acid (DPC) also inhibited luciferin-luciferase activity. |A1:**1SP3E3| |A2:**1SP3E0-| |A3:**1SP3E0| |A4:**1SP3E0-| |A5:**1GP3E0-|
				Annotation	1SP3E3	1SP3E0-	1SP3E0	1SP3E0-	1GP3E0-
				Evidence	4	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
419	621	11087000_385	Sound was delivered to the tympanic membrane by a closed acoustic system comprised of two Bruel & Kjaer 4133 1/2-inch microphones for delivering tones and a single Bruel & Kjaer 3135 1/4-inch microphone for monitoring sound pressure at the tympanum. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	4	2
				Polarity	7	7	7	7	7
420	3108	11313360_6	We tested the ability of staurosporine to inhibit EH-evoked secretion of ETH by EGs in vitro. |A1:**1SN3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3-| |A5:**1GP3E3|
				Annotation	1SN3E3	1SP3E3	1SP3E3	1SP3E3-	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	1	7	7	7	7
421	5903	11278429_9	In this case, p56 lck activation is detectable early (5 min after activation), as is the case in IPP stimulation of gamma9delta2 T cells. |A1:**1SP3E3| |A2:**1SP3E3+| |A3:**1SP3E3| |A4:**1SP3E3+| |A5:**1SP3E3+|
				Annotation	1SP3E3	1SP3E3+	1SP3E3	1SP3E3+	1SP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
422	8317	9224811_228	Whether this is due to an extended TR-binding site or binding of an additional protein(s) is not clear; |A3:**1SP1E0| |A1:**1SP0E3| |A2:**1SP0E0| |A4:**1SP0E0| |A5:**1GN0E0| however, the fact that protein binding occurs further upstream of the P450R-TRE |A3:**2SP3E0| |A5:**2GP3E0| may explain the small but significant drop in T3 induction found in constructs p-575R and p-564R. |A3:**3SP1E0| |A1:**2SP1E0| |A2:**2SP1E0| |A4:**2SP1E0-| |A5:**3GP2E0-|
				Annotation	1SP0E3 2SP1E0 2SP1E0	1SP0E0 2SP1E0 2SP1E0	1SP1E0 2SP3E0 3SP1E0	1SP0E0 2SP1E0- 2SP1E0-	1GN0E0 2GP3E0 3GP2E0-
				Evidence	4 1 1	1 1 1	1 1 1	1 1 1	1 1 1
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	4 5 5	4 5 5	5 7 5	4 5 5	4 7 6
423	9880	12086892_22	The VEGF family is comprised of five structurally related members, including VEGF-A, placenta growth factor (PlGF), VEGF-B, VEGF-C, and VEGF-D (Eriksson and Alitalo, 1999 ). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
424	2366	12062057_130	Because Drosophila males do not undergo recombination or assemble a synaptonemal complex, |A3:**1SN3E0| it is unlikely that ORD functions exclusively in these processes during female meiosis. |A3:**2SP2E0| |A1:**1SP3E1| |A2:**1SN3E1| |A4:**1SN3E0| |A5:**1SN3E0|
				Annotation	1SP3E1 1SP3E1	1SN3E1 1SN3E1	1SN3E0 2SP2E0	1SN3E0 1SN3E0	1SN3E0 1SN3E0
				Evidence	2 2	2 2	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	1 1	1 6	1 1	1 1
425	5871	9271353_95	These data demonstrate that NQO1 can reduce TQ considerably more efficiently than CoQ10. |A1:**1SP1E3| |A2:**1SP2E1-| |A3:**1SP2E3| |A4:**1SP3E3-| |A5:**1GP3E3-|
				Annotation	1SP1E3	1SP2E1-	1SP2E3	1SP3E3-	1GP3E3-
				Evidence	4	2	4	4	4
				Focus	4	4	4	4	1
				Polarity	5	6	6	7	7
426	7151	10698947_306	The recombinant plasmid was named pAD2 and was used to overproduce CrgA. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MSP3E3| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1MSP3E3	1SP3E0	1GP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	6	4	1
				Polarity	7	7	7	7	7
427	9187	11030628_402	A similar approach was used for generating the anti-p-Ser-46 polyclonal antibody. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1SP3E0	1GP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	2	4	1
				Polarity	7	7	7	7	7
428	2878	9475757_238	CAUSSE, M. A., T. M. FULTON, Y. G. CHO, S. N. AHN, and J. CHUNWONGSE et al., 1994 Saturated molecular map of the rice genome based on an interspecific backcross population. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E2	1SP3E2
				Evidence	4	4	1	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
429	7092	11325960_1	Substantial evidence exists in literature to suggest that placental protein 14 (PP14) (recently renamed glycodelin A), exhibits immunosuppressive properties and is an indispensable macromolecule in the maternal system for the establishment, maintenance, and progression of pregnancy. |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1GP3E1|
				Annotation	1SP3E1	1SP3E1	1SP3E1	1SP3E1	1GP3E1
				Evidence	2	2	2	2	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
430	8673	12618190_43	The 40-mer RNA aptamer construct for crystallization trials lacks the hairpin loop and is composed of two strands with single complementary base overhangs at their 5 ends (Figure 1A). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
431	1929	9560388_594	ZACHARIAE, W. and K. NASMYTH, 1996 TPR proteins required for anaphase progression mediate ubiquitination of mitotic B-type cyclins in yeast. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E2	1SP3E2
				Evidence	4	4	1	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
432	5339	12618405_146	As expected from the conservation of the active site sequence motif, recombinant FoTRI201 produced in E. coli could specifically transfer an acetyl group to C-3 of T-2 toxin, nivalenol (NIV), and deoxynivalenol (DON) (Fig 4C). |A1:**1SP1E3| |A2:**1SP2E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP1E3	1SP2E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	5	6	7	7	7
433	1609	9736749_86	Furthermore, a comparison of the two subject groups with regard to the global scale and skew of the hippocampus in three dimensions as derived from the transformations gave a similarly weak result (Hotelling's t2 = 11.8, df = 6, P = 0.19). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP1E0| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP1E0	1SP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	5	7
434	1159	9671490_44	Subclones containing the amino-terminal deletion mutant LEF-1delta56 and the LEF-1HMG domain were constructed by using naturally occurring restriction enzyme sites, HpaI and NdeI, respectively. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1SP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	2	4	2
				Polarity	7	7	7	7	7
435	6772	10952693_5	This was in part due to impaired NO contribution NO-contribution in MI (-50%, P<0.05 versus no MI). |A1:**1SN3E3| |A2:**1GP3E3| |A3:**1SP3E1| |A4:**1SP2E0| |A5:**1GP3E0|
				Annotation	1SN3E3	1GP3E3	1SP3E1	1SP2E0	1GP3E0
				Evidence	4	4	2	1	1
				Focus	4	1	4	4	1
				Polarity	1	7	7	6	7
436	7217	11526109_72	Additionally, when both the PH and PTB domains were mutated, |A3:**1SP3E0| |A5:**1SP3E0| the reduction in plasma membrane association was not detectably different from the effect of the R28C mutation alone. |A3:**2SN3E3| |A1:**1SP3E3| |A2:**1SN3E3| |A4:**1SN3E0-| |A5:**2SN3E0|
				Annotation	1SP3E3 1SP3E3	1SN3E3 1SN3E3	1SP3E0 2SN3E3	1SN3E0- 1SN3E0-	1SP3E0 2SN3E0
				Evidence	4 4	4 4	1 4	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	1 1	7 1	1 1	7 1
437	1349	10454379_186	In mollusks, for example, evidence favors the interpretation that both functions are closely related or identical. |A1:**1GP3E0| |A2:**1GP3E1| |A3:**1SP3E1| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1GP3E0	1GP3E1	1SP3E1	1SP3E0	1SP3E1
				Evidence	1	2	2	1	2
				Focus	1	1	4	4	4
				Polarity	7	7	7	7	7
438	3489	12626754_6	Our study demonstrates that Wnt-5A augments primitive hematopoietic development in vivo |A5:**1SP3E3+| and represents an in vivo regulator of hematopoietic stem cell function in the human. |A5:**2SP3E3| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3+ 2SP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
439	5263	9671454_109	Then, to normalize the transfection efficiency, 50 mul of stop-and-glow buffer was added, and the renilla luciferase activity was determined. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1SP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	2	2	2	4	2
				Polarity	7	7	7	7	7
440	5571	11438642_282	At present much attention is focused on the possibility that Rrn3p activity is controlled by a regulatory cycle |A5:**1SP2E0| in which it dissociates from Pol I during initiation, |A5:**2SP3E0| is inactivated, |A1:**1SP3E3-| |A2:**1SP2E1-| and must be reactivated before it can direct initiation by a second polymerase. |A5:**3SP3E0+| |A1:**2SP2E3| |A2:**2SP2E0| |A3:**1SP2E0| |A4:**1SP3E0|
				Annotation	1SP3E3- 1SP3E3- 1SP3E3- 2SP2E3	1SP2E1- 1SP2E1- 1SP2E1- 2SP2E0	1SP2E0 1SP2E0 1SP2E0 1SP2E0	1SP3E0 1SP3E0 1SP3E0 1SP3E0	1SP2E0 2SP3E0 3SP3E0+ 3SP3E0+
				Evidence	4 4 4 4	2 2 2 1	1 1 1 1	1 1 1 1	1 1 1 1
				Focus	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4
				Polarity	7 7 7 6	6 6 6 6	6 6 6 6	7 7 7 7	6 7 7 7
441	9758	9472020_311	In experiments where the effect of eIF2alpha phosphorylation was assessed, eIF2 in binary complex buffer was first incubated with or without 1 mul (~0.1 mug) of purified rabbit reticulocyte HCR kinase (Jackson and Hunt 1985 ) for 10 min at 23 degrees C. |A1:**1MP3E3| |A2:**1MP3E23| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E23	1SP3E3	1MP3E3	1MP3E3
				Evidence	4	3	4	4	4
				Focus	2	2	4	2	2
				Polarity	7	7	7	7	7
442	6479	9395407_275	For RNA in situ hybridization, we followed the protocol of Tautz and Pfeifle [57] with modifications. |A1:**1MP3E23| |A2:**1SP3E23| |A3:**1MP3E2| |A4:**1MP3E2| |A5:**1MP3E3|
				Annotation	1MP3E23	1SP3E23	1MP3E2	1MP3E2	1MP3E3
				Evidence	3	3	3	3	4
				Focus	2	4	2	2	2
				Polarity	7	7	7	7	7
443	5547	11443132_9	Oxidative stress was induced by a 15-min pulse of H2O2 (25, 50, or 100 muM), and cell survival was measured 18 h later. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3+| |A4:**1MP3E3+| |A5:**1SP3E3+|
				Annotation	1SP3E3	1SP3E3	1MP3E3+	1MP3E3+	1SP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	2	2	4
				Polarity	7	7	7	7	7
444	9485	9727029_229	Our finding that hSOCS-2 binds only to the autophosphorylated IGF-I receptor is consistent with hSOCS-2 SH2 domain binding to a phosphotyrosine containing motif in the receptor. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
445	848	11159982_69	Successful deletion and mutation in the resultant clones were confirmed by restriction analysis with EcoRV and finally verified by automated DNA sequencing. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
446	6810	10394365_19	The T = 4 capsids corresponding to a particular primary patient isolate (CW) but truncated after aa 149 have been crystallized (Wynne et al. 1999). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1MP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1MP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	2	4	1
				Polarity	7	7	7	7	7
447	2951	9407054_69	As shown in Fig. 6 A, the plasma level of TNF-alpha in LPS-treated PLA2R-deficient mice was significantly lower than that in wild-type mice (male PLA2R+/+, PLA2R, 3.64 plus-or-minus 1.17 ng/ml; male PLA2R /, 1.54 plus-or-minus 0.49 ng/ml, p = 0.0143, female PLA2R+/+, PLA2R, 9.61 |A1:**1SP3E3-| |A2:**1SP3E3-| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3-	1SP3E3-	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
448	9185	12046995_1	GOALS: The physicians' decision-making process in terminal care is complex: medical, ethical, legal and psychological aspects are all involved, particularly in critical situations. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1GP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1GP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	1	1
				Polarity	7	7	7	7	7
449	6588	11118449_51	However, the GutR system has its unique aspects that are different from the MalT system. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1MP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1MP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
450	4183	10681542_1	Expression and Purification of Wild Type and Mutant Enzymes-- The porcine NADP-dependent isocitrate dehydrogenase, with glutamine substituted for arginine at each of the positions 101, 110, 120, and 133, were generated using expression vector pMALcIDP1 by a megaprimer PCR method ( ). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1MP3E3| |A4:**1MP3E0| |A5:**1SMP3E3|
				Annotation	1SP3E23	1SP3E23	1MP3E3	1MP3E0	1SMP3E3
				Evidence	3	3	4	1	4
				Focus	4	4	2	2	6
				Polarity	7	7	7	7	7
451	6390	9030530_2	As to GSTs, only Ya Ya Ya-Ya and Ya Yc Ya-Yc could catalyze the reduction of cholesterol 7 hydroperoxides 7-hydroperoxides (Table I). |A1:**1SP2E3| |A2:**1SP2E3| |A3:**1SP3E3-| |A4:**1SP3E3-| |A5:**1SP3E3+|
				Annotation	1SP2E3	1SP2E3	1SP3E3-	1SP3E3-	1SP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	6	6	7	7	7
452	3989	12750340_43	Tissue samples of P. leucopus and P. californicus were furnished by the Peromyscus Stock Center ( http://stkctr.biol. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1GP3E3
				Evidence	4	4	1	1	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
453	5564	12216476_5	We injected puromysin aminonucleoside(PAN) to induce the nephrotic rat state and isolated kidney lysosomes from normal and nephrotic rat kidney cortex by our methods. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	4	2
				Polarity	7	7	7	7	7
454	6235	11014821_339	It should be noted that several of the same Doa alleles that fail to interact with ras pathway components interact to various extents with other mutations affecting eye and imaginal development (C. DU and L. RABINOW, unpublished results), as well as with those influencing sex determination ( D U et al. 1998 ). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
455	4145	11238455_281	These cell lines all exhibit higher GSH levels |A2:**1SP3E1+| than controls after glutamate exposure |A5:**1MP3E3+| and lower levels of ROS and intracellular Ca2+. |A2:**1SP3E0-| |A1:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**2MP3E3-|
				Annotation	1SP3E0 1SP3E0 1SP3E0	1SP3E1+ 1SP3E0- 1SP3E0-	1SP3E0 1SP3E0 1SP3E0	1SP3E3 1SP3E3 1SP3E3	1MP3E3+ 1MP3E3+ 2MP3E3-
				Evidence	1 1 1	2 1 1	1 1 1	4 4 4	4 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	2 2 2
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
456	8598	12021257_88	Thus, CsA had only a minor effect on cytochrome c release as determined by both NGF rescue and immunocytochemistry. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E1| |A4:**1SP3E3| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E1	1SP3E3	1GP3E1
				Evidence	4	4	2	4	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
457	8355	9584203_287	Tax coimmunoprecipitates with cyclin D1 and/or cyclin D3. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
458	2446	12086872_128	The number of genes required for optimal class assignment varied between classes. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP1E0| |A4:**1SP2E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP1E0	1SP2E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	5	6	7
459	9114	11779869_62	The fact that the association of synaptophysin and dynamin is dependent on dissociation of synaptophysin and VAMP 2 is consistent with a role for the dynamin-synaptophysin complex in a step of the SV cycle after SNARE complex formation. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E1	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	2	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
460	335	9660865_84	Intensities of signals were measured by NIH Image 1.58 software. |A1:**1MP3E3| |A2:**1MP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E1	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	2	4	4	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
461	7675	10383396_7	Others have argued that Ins(1,3,4)P3 is converted to Ins(3,4,5,6)P4 by the sequential actions of Ins(1,3,4)P3 6-kinase, Ins(1,3,4,6)P4 1-phosphatase, and Ins(3,4,6)P3 5-kinase ( , , ). |A1:**1SP2E2| |A2:**1SP2E2| |A3:**1SP1E1| |A4:**1SP1E1| |A5:**1SP3E2|
				Annotation	1SP2E2	1SP2E2	1SP1E1	1SP1E1	1SP3E2
				Evidence	3	3	2	2	3
				Focus	4	4	4	4	4
				Polarity	6	6	5	5	7
462	1652	9736749_63	The second step of the transformation, performed in blocks of tissue containing the left and right hippocampus, was driven by individual voxel gray scale values but was constrained by fluid physical properties. |A1:**1GP3E3| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1GP3E3	1SP3E1	1SP3E0	1SP3E0	1MP3E3
				Evidence	4	2	1	1	4
				Focus	1	4	4	4	2
				Polarity	7	7	7	7	7
463	2059	12207891_360	N. Takahashi, S. Ishihara, S. Takada, S. Tsukita and A. Nagafuchi, Posttranscriptional regulation of -catenin expression is required for Wnt signaling in L cells. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E2|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1SP3E2
				Evidence	4	4	1	1	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
464	6592	12668660_20	Mitochondrial control of apoptosis is governed by the BCL-2 family of proteins, which include anti-apoptotic BCL-2 and BCL-xL and pro-apoptotic BAX and BAK; |A3:**1SP3E0| the balance between these opposing members is regulated by a third subgroup called the "`BH3-only"` proteins ( Cory and Adams, 2002). |A3:**2SP3E2| |A1:**1SP3E2| |A2:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E0 2SP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2
				Evidence	3 3	3 3	1 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
465	53	9336330_116	The mean maximal startle response to the 120 dB stimulus presented alone and when preceded by 70, 75 and 80 dB prepulse stimuli (in the aged animal experiment) or by 67, 70 and 75 dB (in the septal lesion experiments) was measured. |A1:**1GP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1GP3E3	1MP3E3	1SP3E3	1SP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	1	2	4	4	2
				Polarity	7	7	7	7	7
466	8611	10601345_71	The hybridization was carried out using an RPA kit (Ambion Inc.) and following the manufacturer's instructions. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
467	4048	12711303_82	DCAP does not affect the canonical Wnt signal pathway |A1:**1SN3E0| |A2:**1SN3E0| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1SN3E0|
				Annotation	1SN3E0	1SN3E0	1SN3E0	1SN3E0	1SN3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	1	1	1	1	1
468	7840	10449458_167	Meanwhile, several groups had gained experience in methods for detection of rhinovirus by RT-PCR, and technological developments such as sample preparation kits and advanced microtiter-format heating blocks favored a switch from virus isolation to RNA detection by RT-PCR. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1MP3E0| |A4:**1MP3E0| |A5:**1SP3E1|
				Annotation	1SP3E0	1SP3E1	1MP3E0	1MP3E0	1SP3E1
				Evidence	1	2	1	1	2
				Focus	4	4	2	2	4
				Polarity	7	7	7	7	7
469	5438	10224275_193	Nuclei were stained for 15 min at room temperature with fresh 4'', 6-diamidinophenylindole 4'',6-diamidinophenylindole (DAPI) solution (1 mug/ml) in phosphate buffer, pH 7, 0.02% Tween-20 containing 0.1 mg/ml p-phenylene diamine as antifading agent. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
470	9698	11689693_158	Interestingly, in more than 90% of transfected cells, GFP-KiD1 alone led to a twofold increase in actin stress fibers (Fig. 2F, a) |A1:**1SP3E3+| |A2:**1SP3E3+| while GFP-KiD2 alone triggered stress fiber disassembly and elongated cell morphology (Fig. 2F, b), |A1:**2SP3E3| |A2:**2SP3E1| |A3:**1SP3E3+| |A4:**1SP3E3+| |A5:**1SP3E3+| which suggests that KiD1 and KiD2 also inhibit endogenous RhoG and RhoA proteins. |A1:**3SN3E3| |A2:**3SP3E1-| |A3:**2SP2E0-| |A4:**1SP2E0-| |A5:**1SP2E3-|
				Annotation	1SP3E3+ 2SP3E3 3SN3E3	1SP3E3+ 2SP3E1 3SP3E1-	1SP3E3+ 1SP3E3+ 2SP2E0-	1SP3E3+ 1SP3E3+ 1SP2E0-	1SP3E3+ 1SP3E3+ 1SP2E3-
				Evidence	4 4 4	4 2 2	4 4 1	4 4 1	4 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 1	7 7 7	7 7 6	7 7 6	7 7 6
471	1909	12743027_165	GSK-3beta is a negative regulator of Wnt signalling (Cohen and Frame, 2001), *1SN3E2 |A2:**1SN3E2| |A3:**1SP3E2| |A4:**1SP3E2| which is inactivated by phosphorylation mediated by Wnt signals or ILK. |A1:**2SN3E3| |A2:**2SP3E0-| |A3:**2SP3E2| |A4:**2SP3E0| |A5:**1SP3E2|
				Annotation	2SN3E3 2SN3E3	1SN3E2 2SP3E0-	1SP3E2 2SP3E2	1SP3E2 2SP3E0	1SP3E2 1SP3E2
				Evidence	4 4	3 1	3 3	3 1	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	1 7	7 7	7 7	7 7
472	1117	9528791_100	Far-Western blot analysis was performed as described by Tarn et al. ( 51) |A3:**1MP3E2| |A4:**1MP3E2| except that 2 x 105 to 4 x 105 cpm of 35S-labeled Prp19p or Snt309p per ml was used in the incubation with blots. |A1:**1MP3E23| |A2:**1MP3E23| |A3:**2MP3E0| |A4:**2MP3E0| |A5:**1MP3E3|
				Annotation	1MP3E23 1MP3E23	1MP3E23 1MP3E23	1MP3E2 2MP3E0	1MP3E2 2MP3E0	1MP3E3 1MP3E3
				Evidence	3 3	3 3	3 1	3 1	4 4
				Focus	2 2	2 2	2 2	2 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
473	1405	9844016_80	In the schizophrenic cohort, there was a 21% decrease in layer I ( P = 0.510), a 34% decrease in layer II ( P = 0.046), a 33% decrease in layer III ( P = 0.040), a 29% decrease in layer IV ( P = 0.089), a 31% decrease in layer V ( P = 0.080), and a 29% decrease in layer VI ( P = 0.112). |A1:**1SP3E3-| |A2:**1SP3E3-| |A3:**1SP3E3-| |A4:**1SP3E0-| |A5:**1SP3E1|
				Annotation	1SP3E3-	1SP3E3-	1SP3E3-	1SP3E0-	1SP3E1
				Evidence	4	4	4	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
474	1077	11923448_21	We explored whether this developmental disruption would, in turn, trigger behavioral changes similar to those observed in animals with the permanent excitotoxic lesion. |A1:**1GP2E3| |A2:**1GP2E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1GP2E3	1GP2E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	4	4
				Polarity	6	6	7	7	7
475	9932	9835621_223	A relationship between the generation of ROIs and NF-kappaB activation has been suggested in ceramide-induced apoptosis (9). |A1:**1SP3E2| |A2:**1SP3E2+| |A3:**1SP2E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2+	1SP2E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	6	7	7
476	1155	12206470_11	Hormonal male contraception, with indirect suppression of spermatogenesis by decreasing gonadotrophin output, is a further choice. |A1:**1SN2E0-| |A2:**1SP1E0-| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0-|
				Annotation	1SN2E0-	1SP1E0-	1SP3E0	1SP3E0	1GP3E0-
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	2	5	7	7	7
477	6193	9390512_162	The limitation of association studies is that candidate genes, as well as functional polymorphisms within these genes or at least polymorphisms in strong disequilibrium, must be identified first before the test can be performed. |A1:**1GP2E0| |A2:**1SP2E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1GP2E0	1SP2E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	4
				Polarity	6	6	7	7	7
478	6172	9316835_74	The reaction mixture was treated with 10% Na2CO3 and extracted twice with ethyl acetate. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
479	982	11976265_6	The results reveal that beta-cells express Rhes |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E1| and suggest that changes in the expression of this molecule may regulate the sensitivity of beta-cells to imidazoline secretagogues. |A3:**2SP2E1| |A1:**1SP1E3| |A2:**1SP1E3| |A4:**2SP2E1| |A5:**2GP2E1|
				Annotation	1SP1E3 1SP1E3	1SP1E3 1SP1E3	1SP3E3 2SP2E1	1SP3E3 2SP2E1	1GP3E1 2GP2E1
				Evidence	4 4	4 4	4 2	4 2	2 2
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	5 5	5 5	7 6	7 6	7 6
480	390	11163269_276	However, among sensory neurons of the L4 DRG, |A5:**1SP3E0| ShcB / mice exhibit a significant reduction in the number of TrkA+ and IB4+ neurons and small-caliber axon fibers. |A5:**2SP3E1-| |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0-| |A4:**1SP3E0-|
				Annotation	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0- 1SP3E0-	1SP3E0- 1SP3E0-	1SP3E0 2SP3E1-
				Evidence	1 1	1 1	1 1	1 1	1 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
481	5445	10197998_44	The PCR fragment was digested with SalI and EcoRI and then ligated to pHY300 PLK that had been digested with SalI and EcoRI, yielding pHYG1. |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	2	2	2	2
				Polarity	7	7	7	7	7
482	370	10704443_144	We could also detect this cross-linked product in vesicles derived from emp24- E178A mutant (data not shown), confirming that vesicle budding occurred using these membranes. |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E1	1SP3E1	1SP3E3	1SP3E3	1SP3E3
				Evidence	2	2	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
483	4675	11526012_71	The column was equilibrated with 20 mM Tris-HCl (pH 8.0) containing 150 mM NaCl, and the separation was carried out isocratically at a flow rate of 0.4 ml/min. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
484	4262	11238375_1	Small GTP-binding proteins of the Rho-family, Rho, Rac, and Cdc42, have been traditionally linked to the regulation of the cellular actin-based cytoskeleton. |A1:**1SP3E1| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E1	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	2	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
485	4575	10207100_114	The result of a BLAST ( 1) search indicated that this sequence was identical to that of the gene encoding the TAFII40 protein ( 28). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
486	3850	8756721_235	Assay is described in detail elsewhere (van de Wetering et al., 1991). |A1:**1MP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1MP3E2|
				Annotation	1MP3E2	1SP3E2	1SP3E2	1SP3E2	1MP3E2
				Evidence	3	3	3	3	3
				Focus	2	4	4	4	2
				Polarity	7	7	7	7	7
487	2507	10619028_478	We thank R. Jain and C. Nassif for help with sequencing and cloning. |A1:**1GP3E0| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1GP3E3| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP3E3	1SP3E3	1GP3E3	1GP3E0
				Evidence	1	4	4	4	1
				Focus	1	1	4	1	1
				Polarity	7	7	7	7	7
488	4389	8598046_323	Flies bearing new insertions have two-toned eyes, with lighter lower halves. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1GP3E0| |A5:**1SP3E1|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1GP3E0	1SP3E1
				Evidence	1	1	1	1	2
				Focus	1	4	4	1	4
				Polarity	7	7	7	7	7
489	3344	12061758_4	In Experiments 2B and 2C, we manipulated the amount of weight that people simulated lifting in order to address potential alternative explanations of the inflation effect. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E3	1GP3E3	1GP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
490	927	12037584_7	In contrast, resident macrophages from the peritoneum showed the expected NO response, |A5:**1SP3E3| and purified Leydig cells produced significant NO regardless of the presence or absence of LPS. |A5:**2SP3E3+| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SN3E3| |A4:**1SN3E0|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SN3E3 1SN3E3	1SN3E0 1SN3E0	1SP3E3 2SP3E3+
				Evidence	4 4	4 4	4 4	1 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	1 1	1 1	7 7
491	3808	11997515_561	Axin, a negative regulator of the Wnt signaling pathway, |A1:**1SP3E0| directly interacts with Adenomatous Polyposis Coli and regulates the stabilization of beta-catenin. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
492	2910	11313474_245	Thus it is unlikely that the mRNA transport and alternative splicing activities of hnRNPA1 are involved in the ability of hnRNPA1 to influence NF-kappaB-dependent transcription. |A1:**1SP3E1| |A2:**1SN2E1| |A3:**1SP1E0| |A4:**1SP3E0| |A5:**1SN3E0|
				Annotation	1SP3E1	1SN2E1	1SP1E0	1SP3E0	1SN3E0
				Evidence	2	2	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	2	5	7	1
493	7647	11960452_9	The structure of the "molecular cap" with its disrupted terminal base pair |A5:**1SP3E0| may also be helpful for modeling how quinolones block re-ligation of DNA strands in the active site of gyrases. |A5:**2SP2E0-| |A1:**1SP1E0| |A2:**1SP1E0| |A3:**1SP2E0| |A4:**1SP2E0|
				Annotation	1SP1E0 1SP1E0	1SP1E0 1SP1E0	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1SP3E0 2SP2E0-
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	5 5	6 6	6 6	7 6
494	97	10102275_203	There is a poor structural correspondence between Kir 2.1 and KcsA in the residues at the M2/M2 intersubunit interface and the pore-lining residues. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
495	3061	7721857_3	From this screen 28 independent plasmids were isolated and grouped into three families on the basis of Southern analysis. |A1:**1MSP3E3| |A2:**1MP3E3| |A3:**1MSP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MSP3E3	1MP3E3	1MSP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	6	2	6	2	2
				Polarity	7	7	7	7	7
496	8118	10205165_240	This implies that alphavbeta3-dependent cell migration is co-ordinated with cell proliferation, which is interesting since alphavbeta3 plays an important role in regulating both intra- and extracellular activities that are involved in promoting cell migration and cell growth. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E3	1SP3E1	1SP3E0	1SP3E0	1SP3E0
				Evidence	4	2	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
497	2654	11713294_281	Formation of these complexes required that responding B cells express the ITIM-bearing FcgammaRII. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
498	7409	9020177_12	DTP overexpression is demonstrated by the SDS-PAGE profile, depicted in Fig. |A1:**1SP3E3+| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E3+| |A5:**1SP3E3+|
				Annotation	1SP3E3+	1SP3E3	1MP3E3	1SP3E3+	1SP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	2	4	4
				Polarity	7	7	7	7	7
499	8412	8702594_44	The low field region of the 1H spectrum (5.8-4.4 ppm) was complex indicating the sample to be a mixture of two related decasaccharides. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SMP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1SMP3E3
				Evidence	4	4	1	1	4
				Focus	4	4	4	4	6
				Polarity	7	7	7	7	7
500	158	10207091_43	Briefly, the phosphorothioate-containing oligonucleotides were 5''-end labeled with 32P by using T4 polynucleotide kinase and annealed to a fivefold excess of its unlabeled complement. |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	2	2	2	2
				Polarity	7	7	7	7	7
501	7012	7721857_41	Thus, the cross-linking of CDC34 to itself reflects a specific set of interactions between CDC34 monomers. |A1:**1SP3E0| |A2:**1SP1E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E0	1SP1E1	1SP3E0	1SP3E0	1SP3E1
				Evidence	1	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	5	7	7	7
502	2263	10611225_100	However, deletion of the eIF4E binding site markedly (80%) reduced cap-dependent 40S ribosomal binding (compare lanes 5 and 6). |A1:**1SP3E3-| |A2:**1SP3E3-| |A3:**1SP3E3-| |A4:**1SP3E3-| |A5:**1SP3E3-|
				Annotation	1SP3E3-	1SP3E3-	1SP3E3-	1SP3E3-	1SP3E3-
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
503	8241	12184965_6	RESULTS: Activities of daily living (ADL) dependency (odds ratio [OR] = 5.3, P =.03), years since symptoms first started (OR = 1.84, P =.03), and the presence of somatic comorbidity (OR = 0.48, P =.02) independently contributed to the prediction of the presence or absence of dementia. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E1|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E1
				Evidence	4	4	4	4	2
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
504	3040	9802880_25	Nonetheless, previous work has established that these cancers overexpress many mitogenic growth factors and their receptors ( 23) |A4:**1SP3E2+| |A5:**1SP3E2+| including a number of heparin-binding growth factors such as FGF1, FGF2, FGF5, HB-EGF, and amphiregulin ( 24-27). |A4:**2SP3E0| |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2+| |A5:**2SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2+ 1SP3E2+	1SP3E2+ 2SP3E0	1SP3E2+ 2SP3E2
				Evidence	3 3	3 3	3 3	3 1	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
505	4731	12718879_139	Reactions containing inhibitors (lanes 5-7) were incubated for 30 min. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	4	2	2
				Polarity	7	7	7	7	7
506	6421	12000196_5	The mutation was found in an Italian family with 5 patients over 3 generations. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E1| |A4:**1SP3E0| |A5:**1SP3E3|
				Annotation	1GP3E3	1SP3E3	1SP3E1	1SP3E0	1SP3E3
				Evidence	4	4	2	1	4
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
507	6558	9390512_143	Interestingly, the lod score increased to 2.6 when individuals with affective disorders (bipolar, major depression) were included in the analyses. |A1:**1GP3E3+| |A2:**1SP3E3+| |A3:**1SP3E3+| |A4:**1SP3E0+| |A5:**1SP3E3|
				Annotation	1GP3E3+	1SP3E3+	1SP3E3+	1SP3E0+	1SP3E3
				Evidence	4	4	4	1	4
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
508	7071	9242700_12	These RNAs were capable of hybridizing with globin mRNA (,). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E1| |A4:**1SP3E0| |A5:**1SP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E1	1SP3E0	1SP3E2
				Evidence	3	3	2	1	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
509	2198	9545294_157	The spectrum of oxidized XylT exhibited three maxima due to the chromophore at 336, 416, and 456 nm, as well as a shoulder near 540 nm. |A1:**1SP3E0| |A2:**1SP2E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E0	1SP2E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	1	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	6	7	7	7
510	9714	10821833_31	We note that an intense DNase I cut site, but not hydroxyl radical cut site, also occurs at 31, being strong in both naked 5 S rDNA and the 5 S nucleosome ( star in Fig. 2 B, lanes 5-8). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SN3E3| |A4:**1SN3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SN3E3	1SN3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	1	1	7
511	4478	11238208_115	In summary, transcript quantification by LightCycler can be successfully applied to gain insight into temporal bacterial gene expression in vivo if performed carefully. |A1:**1SP2E0| |A2:**1SP2E0| |A3:**1SP3E0| |A4:**1MP3E3| |A5:**1SMP3E3|
				Annotation	1SP2E0	1SP2E0	1SP3E0	1MP3E3	1SMP3E3
				Evidence	1	1	1	4	4
				Focus	4	4	4	2	6
				Polarity	6	6	7	7	7
512	6706	9585507_83	In posterior Ubx clones in the haltere disc, Wg is expressed along the DV boundary (Fig. 3C), |A2:**1SP3E2| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3+| suggesting that Ubx represses the posterior portion of the Wg expression pattern. |A2:**1SP3E3-| |A1:**1SN3E3| |A3:**2SP3E1-| |A4:**2SP3E1-| |A5:**2SP2E3-|
				Annotation	1SN3E3 1SN3E3	1SP3E2 1SP3E3-	1SP3E3 2SP3E1-	1SP3E3 2SP3E1-	1SP3E3+ 2SP2E3-
				Evidence	4 4	3 4	4 2	4 2	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	7 7	7 7	7 7	7 6
513	5476	10768944_173	Similar results have been obtained in rhesus monkeys (24) and in mice (11). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
514	7379	12230117_1	Oral administration of the perilla leaf extract (PLE) to mice inhibits inflammation, allergic response, and tumor necrosis factor-alpha production. |A1:**1GN3E0| |A2:**1SP3E0-| |A3:**1SP3E1-| |A4:**1SP3E0-| |A5:**1SP3E0-|
				Annotation	1GN3E0	1SP3E0-	1SP3E1-	1SP3E0-	1SP3E0-
				Evidence	1	1	2	1	1
				Focus	1	4	4	4	4
				Polarity	1	7	7	7	7
515	5696	11238388_271	The collection of A-clones in the A. nidulans project mapped to the centromeres (P RADE et al. 1997 ). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
516	7306	9797273_90	Membranes were incubated in a renaturation buffer (0.1 M Tris-HCl [pH 7.0], 2% Triton X-100 [28]) for 30 min. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
517	9267	9463381_233	Briefly, lysates prepared from 1-2x106 cells were incubated with ~5 mug primary antibody followed by protein G- or protein A-Sepharose (Pharmacia) and then pelleted, washed, fractionated by SDS-PAGE and transferred to nitrocellulose membranes by electroblotting. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
518	5798	12224816_5	After adjustment for age, gender, diabetes mellitus, hypertension, smoking, body mass index, total cholesterol, and high density lipoprotein cholesterol, the odds ratio for acute myocardial infarction was 2.97 (95% confidence interval, 1.37-6.41; |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
519	1121	12034774_21	The RhoA - actin signaling pathway regulates a subset of SRF target genes including vinculin, beta-actin, SRF itself, SM22, and sm-alpha actin ( Sotiropoulos et al., 1999; Gineitis and Treisman, 2001; Mack et al., 2001). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
520	6800	9139723_91	C, AtT-20/PAM-1 cells expressing P-CIP10 were incubated in medium containing [35S]Met/Cys for 15 min ( P) and chased for 1, 2, or 4 h before immunoprecipitation of P-CIP10. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
521	9602	9732415_78	Cytochrome P450 content was determined as described by Omura and Sato (1964). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E1| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E1	1SP3E2	1GP3E2
				Evidence	3	3	2	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
522	4112	9636222_165	Although PC-PLC is involved in several models of programmed cell death, PC-PLC regulates glutamate-induced nerve cell death through a different mechanism. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
523	9454	9742132_201	Moreover, they demonstrate that ribose methylation of the injected cyclin B1 RNA is very inefficient |A5:**1SN3E1| and appears not to require polyadenylation. |A5:**2SN2E1| |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SN2E3| |A4:**1SN2E3|
				Annotation	1SP3E1 1SP3E1	1SP3E1 1SP3E1	1SN2E3 1SN2E3	1SN2E3 1SN2E3	1SN3E1 2SN2E1
				Evidence	2 2	2 2	4 4	4 4	2 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	2 2	2 2	1 2
524	644	11502253_334	Further analysis of the function and regulation of Ngn2 and other bHLH genes will shed more light |A5:**1SP3E0| on how these genes may act to synchronize genetic pathways that specify neuronal identity with the progression of neural lineage development. |A5:**2SP0E0| |A1:**1SP1E0| |A2:**1SP1E1| |A3:**1SP3E0| |A4:**1SP2E3|
				Annotation	1SP1E0 1SP1E0	1SP1E1 1SP1E1	1SP3E0 1SP3E0	1SP2E3 1SP2E3	1SP3E0 2SP0E0
				Evidence	1 1	2 2	1 1	4 4	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	5 5	7 7	6 6	7 4
525	7056	9208845_330	Positive cultures were subcloned twice by limiting dilution in 96-well plates. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
526	5004	11076964_267	Contribution of Myo1p Domains to Function ll known defects of deltamyo1 cells are corrected by a construct with just the head and TH1 domains, |A5:**1SP3E1| a protein similar to a short-tailed myosin-I - like brush border myosin-I. |A5:**2SP3E0| |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0|
				Annotation	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E1 2SP3E0
				Evidence	1 1	1 1	1 1	1 1	2 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
527	7459	11113198_146	No significant differences were found between the wild type and any of the mutant forms of CDC42, |A5:**1SN3E1| |A3:**1SN2E3| |A4:**1SN2E3| demonstrating that developmental phenotypes are caused by altered function |A5:**2SP3E1| and not by intracellular amounts of the different Cdc42p mutant proteins. |A5:**3SN3E0| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**2SN3E3| |A4:**2SN3E3|
				Annotation	1SP3E3 1SP3E3 1SP3E3	1SP3E3 1SP3E3 1SP3E3	1SN2E3 2SN3E3 2SN3E3	1SN2E3 2SN3E3 2SN3E3	1SN3E1 2SP3E1 3SN3E0
				Evidence	4 4 4	4 4 4	4 4 4	4 4 4	2 2 1
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	7 7 7	2 1 1	2 1 1	1 7 1
528	463	10197532_65	At this stage in development, when axons are contacting most of the dendrite surface, we found that the dendrite marker MAP2 was most useful for identifying axonal versus dendritic domains; labeled axons were identified as myc-positive, MAP2-negative, long, fine caliber processes that typically extended far beyond the somatodendritic domain. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
529	8627	12194857_194	However, the molecular machinery required for the formation of these late endosomal compartments has only recently begun to be characterized. |A1:**1GP2E0| |A2:**1SP2E0| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1SP3E1|
				Annotation	1GP2E0	1SP2E0	1SP3E1	1SP3E1	1SP3E1
				Evidence	1	1	2	2	2
				Focus	1	4	4	4	4
				Polarity	6	6	7	7	7
530	8468	12033758_5	A hypothesis about the noise that frequently accompanies this release is offered |A5:**1SP1E1| and includes anatomic, physiologic, and functional models of articular release. |A5:**2SP3E0| |A1:**1GP3E1| |A2:**1GP3E1| |A3:**1SP2E1| |A4:**1SP2E1|
				Annotation	1GP3E1 1GP3E1	1GP3E1 1GP3E1	1SP2E1 1SP2E1	1SP2E1 1SP2E1	1SP1E1 2SP3E0
				Evidence	2 2	2 2	2 2	2 2	2 1
				Focus	1 1	1 1	4 4	4 4	4 4
				Polarity	7 7	7 7	6 6	6 6	5 7
531	8917	10688668_126	Protein concentrations in cytoplasmic and nuclear extracts were measured with a Bio-Rad protein assay kit, and samples containing 20 mug were prepared and used for SDS-PAGE and Western blotting (see "Immunoprecipitation, immunoblotting, and immunocomplex kinase assays"` above). |A1:**1MP3E3| |A2:**1MSP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MSP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	6	2	2	2
				Polarity	7	7	7	7	7
532	7566	10523671_113	Plasmid LexAG4-225-797 (pAKS44), which encodes a LexA (aa 1 to 202)-Gal4 (aa 225 to 797) fusion protein, was constructed by fusing GAL4 codons 225 to 797 to LEXA codons 1 to 202 in pEG202 (from R. Brent). |A1:**1SP3E3| |A2:**1MP3E23| |A3:**1MP3E1| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1MP3E23	1MP3E1	1SP3E0	1MP3E3
				Evidence	4	3	2	1	4
				Focus	4	2	2	4	2
				Polarity	7	7	7	7	7
533	2001	10523632_9	This suggests a distinct nonredundant role for Fps/Fes in signaling from the GM-CSF receptor |A3:**1SP2E0| |A4:**1SP2E0| that does not extend to the closely related IL-3 receptor. |A3:**2SN3E0| |A1:**1SP3E0| |A2:**1SP3E1| |A4:**2SN3E0| |A5:**1SN3E1|
				Annotation	1SP3E0 1SP3E0	1SP3E1 1SP3E1	1SP2E0 2SN3E0	1SP2E0 2SN3E0	1SN3E1 1SN3E1
				Evidence	1 1	2 2	1 1	1 1	2 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	6 1	6 1	1 1
534	2361	9809063_90	After 2 days, the cells were radiolabeled with 35S-methionine for 2 hr, then extracts were prepared and protein complexes were immunoprecipitated using antibodies specific for Pim-1 (lanes 1, 4, and 7) or p100 (anti-FLAG; lanes 2, 5, and 8), or with control, nonimmune antibodies (lanes 3, 6, and 9). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
535	7904	9813013_155	Sedimentation velocity was measured at 50,000 rpm at 20 degrees C with scans shown at 10-min intervals. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
536	7336	10799454_50	Briefly, MT-2 cells (AIDS Research and Reference Reagent Program, NIH) and PHA-stimulated PBMCs from donors were infected with primary HIV-1 isolates in parallel. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E1| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E1	1SP3E0	1MP3E3
				Evidence	4	4	2	1	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
537	5323	9891076_293	It has been suggested that PKC mediates inhibition of GSK-3 by Wnt signaling (8). |A1:**1SN3E2| |A2:**1SP2E2-| |A3:**1SP2E2-| |A4:**1SP2E2-| |A5:**1SP2E2|
				Annotation	1SN3E2	1SP2E2-	1SP2E2-	1SP2E2-	1SP2E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	1	6	6	6	6
538	4307	10611252_35	Comparison of the amino acid sequence of the full-length 1.8-kb ORF with that of human XRCC1 by using Multiple Alignment Construction and Analysis Workbench (MACAW) |A5:**1MP3E3| revealed significant homology to human XRCC1 (37.7% identity; 55.2% similarity). |A5:**2SP3E3| |A1:**1SP3E0| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3|
				Annotation	1SP3E0 1SP3E0	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1MP3E3 2SP3E3
				Evidence	1 1	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	2 4
				Polarity	7 7	7 7	7 7	7 7	7 7
539	4434	10585437_3	In contrast to the C-domain, the size of the CP1 insertion is conserved across bacteria, archaebacteria, and eukaryotes. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
540	2320	9844016_72	These show the pattern of distribution of gamma2 mRNA transcripts across all six cortical layers. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E0	1SP3E1	1SP3E3	1SP3E3	1SP3E3
				Evidence	1	2	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
541	7911	9784521_183	These localizations are consistent with the sequential development of the apoptotic process, |A5:**1SP3E3| |A3:**1SP3E0| i.e., |A4:**1SP3E0| the initial expression of the p53 apoptosis-inducing protein in the parabasal layers, |A5:**2SP3E3+| and consequent detection of DNA damage in the more superficial layers (Fig. 1B and C). |A5:**3SP3E3| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**2SP3E3| |A4:**2SP3E3|
				Annotation	1SP3E3 1SP3E3 1SP3E3 1SP3E3	1SP3E3 1SP3E3 1SP3E3 1SP3E3	1SP3E0 2SP3E3 2SP3E3 2SP3E3	1SP3E0 1SP3E0 2SP3E3 2SP3E3	1SP3E3 2SP3E3+ 2SP3E3+ 3SP3E3
				Evidence	4 4 4 4	4 4 4 4	1 4 4 4	1 1 4 4	4 4 4 4
				Focus	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4
				Polarity	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7
542	774	10090727_119	Although the area of expression is expanded in the compound mutant embryos as compared with wild-type embryos, |A3:**1SP3E0| |A4:**1SP3E0| we favor the view that the expanded expression is due to the generation of excess neural ectoderm at the expense of mesoderm, |A3:**2SP3E3| |A4:**2SP3E3| |A5:**1SP3E2+| rather than a loss of negative regulation, which has been shown to operate in the absence of Wnt signals (Cavallo et al. 1998; Waltzer and Bienz 1998 ). |A3:**3SP3E2-| |A1:**1SP3E23| |A2:**1SP3E23| |A4:**3SP3E2-| |A5:**2SP3E2-|
				Annotation	1SP3E23 1SP3E23 1SP3E23	1SP3E23 1SP3E23 1SP3E23	1SP3E0 2SP3E3 3SP3E2-	1SP3E0 2SP3E3 3SP3E2-	1SP3E2+ 1SP3E2+ 2SP3E2-
				Evidence	3 3 3	3 3 3	1 4 3	1 4 3	3 3 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
543	8137	12005883_6	These results suggest the possibility that the relative change in correlation dimension can be a useful global measure of brain dynamics, |A5:**1SP2E1| e.g., in determining the levels of mental activity, even if little is known about the underlying neurological processes. |A5:**2SP3E1| |A1:**1GP3E3| |A2:**1SP2E3| |A3:**1SP2E3| |A4:**1SP2E3|
				Annotation	1GP3E3 1GP3E3	1SP2E3 1SP2E3	1SP2E3 1SP2E3	1SP2E3 1SP2E3	1SP2E1 2SP3E1
				Evidence	4 4	4 4	4 4	4 4	2 2
				Focus	1 1	4 4	4 4	4 4	4 4
				Polarity	7 7	6 6	6 6	6 6	6 7
544	3409	10985388_101	The secondary antibodies were either Cy3- or Cy2-conjugated anti-guinea pig, Cy3-conjugated anti-rabbit and Cy3-conjugated anti-mouse (Jackson ImmunoResearch Laboratories). |A1:**1SP2E3| |A2:**1SP2E3| |A3:**1SP2E1| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP2E3	1SP2E3	1SP2E1	1SP3E0	1MP3E3
				Evidence	4	4	2	1	4
				Focus	4	4	4	4	2
				Polarity	6	6	6	7	7
545	843	9390512_196	Despite the fact that both D3 and 5-HT2AR genes seem to have at best a weak effect on schizophrenia susceptibility, |A5:**1SP3E1| these could in principle be important findings, as they could offer an anchor for further biological studies. |A5:**2SP3E0| |A1:**1SP2E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP2E0|
				Annotation	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1SP3E1 2SP3E0
				Evidence	1 1	1 1	1 1	1 1	2 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	6 6	6 6	6 6	6 6	7 7
546	2906	9331371_185	One of the two residues mutated in the g region (T1080) is conserved in all RNA polymerases, and like the sua8 suppressors in the c and d regions (see above), the position of the sua8 suppressor in the h region is conserved in all RNA polymerases aligned aligned. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E0	1SP3E1	1SP3E3	1SP3E3	1SP3E3
				Evidence	1	2	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
547	5618	8986719_222	Therefore, this JAK3-independent IL-4 signaling pathway may be important in leukocytes when levels of JAK3 are minimal. |A1:**1SP1E1| |A2:**1SP2E1| |A3:**1SP1E0| |A4:**1SP2E0| |A5:**1SP2E1|
				Annotation	1SP1E1	1SP2E1	1SP1E0	1SP2E0	1SP2E1
				Evidence	2	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	5	6	5	6	6
548	9819	9555896_80	With glucose and succinate, growth of P. putida commenced at very low pO2 values and showed a saturation curve with increasing pO2. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3+| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3+	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
549	667	8996174_85	In the rabbit aorta and the prostate phenylephrine elicited contractions with potencies (EC50) of approximately 0.3 and 4 muM, respectively. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E3|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E3
				Evidence	1	1	1	1	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
550	4878	11090626_321	In this case, another Flp monomer, instead of a special enzyme, may be sufficient to resolve the covalent linkage between the tyrosine and DNA, |A5:**1SP2E3| even if the original attacking Flp monomer has become denatured and/or degraded. |A5:**2SP3E3| |A1:**1SP1E1| |A2:**1SP1E1| |A3:**1SP2E0| |A4:**1SP2E0|
				Annotation	1SP1E1 1SP1E1	1SP1E1 1SP1E1	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1SP2E3 2SP3E3
				Evidence	2 2	2 2	1 1	1 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	5 5	6 6	6 6	6 7
551	9432	11319104_56	Forty-one cycles of amplification were done under the following conditions: denaturation at 95 degrees C for 1 min, annealing at 66 degrees C for 1 min, and extension at 72 degrees C for 2 min. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
552	2769	11913030_3	Changes in the usual way of speaking are frequently observed after behavioural treatments for adults who stutter, |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1SP3E1| and it is possible that operant treatments for children also invoke such changes. |A3:**2SP2E0| |A1:**1GP2E0| |A2:**1GP2E0| |A4:**2SP2E0| |A5:**2SP2E1|
				Annotation	1GP2E0 1GP2E0	1GP2E0 1GP2E0	1SP3E1 2SP2E0	1SP3E1 2SP2E0	1SP3E1 2SP2E1
				Evidence	1 1	1 1	2 1	2 1	2 2
				Focus	1 1	1 1	4 4	4 4	4 4
				Polarity	6 6	6 6	7 6	7 6	7 6
553	2267	12810698_239	These findings differ from those obtained with embryos and cancer cells that have a strongly activated Wnt pathway |A5:**1SP3E12| in which expression of E-cadherin antagonizes beta-catenin/TCF signaling ( Heasman et al., 1994; Funayama et al., 1995; Fagotto et al., 1996; Sanson et al., 1996; Gottardi et al., 2001). |A5:**2SP3E2-| |A1:**1SP3E2| |A2:**1SP3E12| |A3:**1SP3E2+| |A4:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E12 1SP3E12	1SP3E2+ 1SP3E2+	1SP3E2 1SP3E2	1SP3E12 2SP3E2-
				Evidence	3 3	2 2	3 3	3 3	2 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
554	6009	11294857_2	Several cell types, including neuroendocrine chromaffin cells, have evolved to sense oxygen levels and initiate specific adaptive responses to hypoxia. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1+|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E1+
				Evidence	1	1	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
555	81	9153218_14	We found that transcription of the rrn operon in intact spinach plants is regulated by usage of two promoters. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
556	9151	12477929_29	However, comparison of the increase in the morbid risk of schizophrenia associated with the identified PRODH2 variation |A3:**1SP3E0+| |A4:**1SP3E0+| |A5:**1GP3E0+| to the risk associated with the 22q11 microdeletion could not exclude contribution from other genes in the region. |A3:**2SN3E0| |A1:**1SP2E0| |A2:**1SP3E0| |A4:**2SN3E0| |A5:**2SN3E0|
				Annotation	1SP2E0 1SP2E0	1SP3E0 1SP3E0	1SP3E0+ 2SN3E0	1SP3E0+ 2SN3E0	1GP3E0+ 2SN3E0
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	1 4
				Polarity	6 6	7 7	7 1	7 1	7 1
557	7067	10358016_35	Ca2+-induced beta-hexosaminidase release was reduced by approximately 35% in the mastoparan-treated cells (Fig. 4 b), consistent with the similarly reduced (40%) levels of cytosolic cAMP detected in response to forskolin after mastoparan treatment (Fig. 4 d). |A1:**1SP3E3-| |A2:**1SP3E3-| |A3:**1SP3E3-| |A4:**1SP3E3-| |A5:**1SP3E3-|
				Annotation	1SP3E3-	1SP3E3-	1SP3E3-	1SP3E3-	1SP3E3-
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
558	5250	11333245_158	These clustered breaksites are indicated by brackets, and the breaksite sequences are aligned. |A1:**1SP3E1| |A2:**1GP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E1	1GP3E1	1SP3E0	1SP3E0	1GP3E3
				Evidence	2	2	1	1	4
				Focus	4	1	4	4	1
				Polarity	7	7	7	7	7
559	7314	11792731_168	The accretion of DHA during fetal brain development has been widely studied. |A1:**1SP3E1| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E1|
				Annotation	1SP3E1	1SP3E0	1SP3E0	1SP3E0	1GP3E1
				Evidence	2	1	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
560	6510	9643351_181	While the initial lipid compositions of the incubation media resulted in the formation of uniform, mixed lipid mixed-lipid micelles, |A3:**1SP3E0| |A4:**1SP3E0| the aggregation state of medium lipids could be altered during cell incubations by the disproportional depletion of medium lipids stemming from the unequal rates of lipid uptake. |A3:**2SP2E0| |A1:**1SP2E0| |A2:**1SP2E0| |A4:**2SP2E0| |A5:**1SP3E1|
				Annotation	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1SP3E0 2SP2E0	1SP3E0 2SP2E0	1SP3E1 1SP3E1
				Evidence	1 1	1 1	1 1	1 1	2 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	6 6	6 6	7 6	7 6	7 7
561	4837	10417164_42	Mice were infected intravenously via the tail vein with 2 x 105 live bacilli in 100 mul, as determined by viable counts on 7H10 agar plates (Difco Laboratories, Detroit, Mich.). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1MP3E2| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1MP3E2	1MP3E3
				Evidence	4	4	4	3	4
				Focus	2	2	4	2	2
				Polarity	7	7	7	7	7
562	7907	12019609_3	Production of 14CO2 was measured by incubating cells in media containing either D-[U-14C] glucose, [1-14C] n-butyrate, L-[U-14C] glutamine, D-[U-14C]glucose, [1-14C]n-butyrate, L-[U-14C]glutamine, or [1-14C]propionate with or without competing substrates. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
563	2084	9671478_48	In the presence of cellular extracts, a 200-bp fragment can still serve as a substrate ( 6). |A1:**1SP2E2| |A2:**1SP2E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP2E2	1SP2E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	6	6	7	7	7
564	508	10473520_100	Following the identification of BDV RNA in peripheral blood mononuclear cells (PBMC) of experimentally infected rats ( 23), Bode et al. ( 5) |A3:**1SP3E2| |A4:**1SP3E2| reported finding BDV protein in CD14+ PBMC and RNA in PBMC from psychiatric patients. |A1:**1SP3E2| |A2:**1SP3E2| |A3:**2SP3E1| |A4:**2SP3E1| |A5:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 2SP3E1	1SP3E2 2SP3E1	1SP3E2 1SP3E2
				Evidence	3 3	3 3	3 2	3 2	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
565	8989	11978848_33	Specifically, no significant differences in callosal areas were found between monozygotic (MZ) co-twins discordant for schizophrenia (Casanova et al., 1990b), |A2:**1SN3E23| |A5:**1GN3E2| suggesting no disease-specific influences. |A2:**2SN3E3| |A1:**1SN3E23| |A3:**1SN3E2| |A4:**1SN3E2| |A5:**2GN2E2|
				Annotation	1SN3E23 1SN3E23	1SN3E23 2SN3E3	1SN3E2 1SN3E2	1SN3E2 1SN3E2	1GN3E2 2GN2E2
				Evidence	3 3	3 4	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	1 1	1 1	1 1	1 1	1 2
566	2471	9531542_53	Splice variants of CD44 are expressed in putative limb ectoderm and become localized to the AER. |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E1	1SP3E1	1SP3E0	1SP3E0	1SP3E1
				Evidence	2	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
567	5105	11812828_180	SFRPs bind to Wnt ligands and modulate their action. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
568	4882	12176308_19	The cellular zonation and multi-functionality of these digestive filaments suggest another example of a cnidarian structure at the organ level of complexity. |A1:**1GP2E0| |A2:**1SP2E1| |A3:**1SP2E1| |A4:**1SP2E1| |A5:**1SP2E0|
				Annotation	1GP2E0	1SP2E1	1SP2E1	1SP2E1	1SP2E0
				Evidence	1	2	2	2	1
				Focus	1	4	4	4	4
				Polarity	6	6	6	6	6
569	8152	9331371_244	Forty microliters of whole cell extract (Maroney et al. 1990) |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1MP3E2| was incubated with an equal volume of preimmune or alpha-CSH499 beads. |A3:**2MP3E3| |A1:**1MP3E23| |A2:**1MP3E23| |A4:**2MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E23 1MP3E23	1MP3E23 1MP3E23	1SP3E2 2MP3E3	1SP3E2 2MP3E3	1MP3E2 1MP3E3
				Evidence	3 3	3 3	3 4	3 4	3 4
				Focus	2 2	2 2	4 2	4 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
570	7128	12821645_212	Fatp4 -/- mice display a significant thickening of the epidermis with a "`too-small-for-size"` volume and a more compact dermis, |A5:**1SP3E1| accompanied by a smaller number of pilo-sebaceous structures and a reduced amount of fatty tissue in the hypodermis. |A5:**2SP3E1-| |A1:**1SP3E0-| |A2:**1SP3E0-| |A3:**1MP3E3| |A4:**1MP3E3|
				Annotation	1SP3E0- 1SP3E0-	1SP3E0- 1SP3E0-	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1SP3E1 2SP3E1-
				Evidence	1 1	1 1	4 4	4 4	2 2
				Focus	4 4	4 4	2 2	2 2	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
571	4972	9573199_200	The Ndh enzyme of E. coli catalyzes the first step in the respiratory chain: NADH oxidation |A5:**1SP3E2+| and quinone reduction (54). |A5:**2SP3E2-| |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2+ 2SP3E2-
				Evidence	3 3	3 3	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
572	5764	10197540_144	The white/gray matter boundary was finally tesselated in a single step using two triangles for each side of a voxel located at the margin of white matter. |A1:**1GP3E3| |A2:**1GP2E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1GP3E3	1GP2E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	4	2
				Polarity	7	6	7	7	7
573	5296	11086983_95	Yellow bars denote distribution of all expressed genes within the same microarray comparison. |A1:**1MP3E3| |A2:**1SP3E0| |A3:**1MP3E1| |A4:**1MP3E3| |A5:**1GP3E0|
				Annotation	1MP3E3	1SP3E0	1MP3E1	1MP3E3	1GP3E0
				Evidence	4	1	2	4	1
				Focus	2	4	2	2	1
				Polarity	7	7	7	7	7
574	3065	11861558_172	The rectangles indicate the critical regions I, II, and III defined by the deletions deltaB1, deltaDEB-342, and delta4R, respectively. |A1:**1SP3E3| |A2:**1SP2E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1SP3E3	1SP2E0	1SP3E3	1SP3E3	1GP3E0
				Evidence	4	1	4	4	1
				Focus	4	4	4	4	1
				Polarity	7	6	7	7	7
575	7405	10953060_17	There are tight correlations between ligand structure, cytotoxicity, and DNA binding kinetics for the 9-aminoacridine-4-carboxamide class of compounds (Atwell et al., 1984; Denny et al., 1986, 1987; Rewcastle et al., 1986; Wakelin et al., 1987). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
576	4462	10555149_176	PPARdelta and PPAR activity was assessed as transcriptional activity of the DRE and ACO luciferase reporters, respectively. |A1:**1MP3E3| |A2:**1SP2E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1MP3E3	1SP2E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	2	4	4	4	4
				Polarity	7	6	7	7	7
577	3815	9430227_165	Previous studies have shown that the death domains of TNFR1 and DR3 are similarly responsible for both these activities, |A1:**1SP3E1| |A2:**1SP3E1| and these results can be explained mechanistically by the ability of their death domains to recruit TRADD ( Tartaglia et al. 1993 ; Kitson et al. 1996 ). |A1:**2SP2E2| |A2:**1SP2E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E1 2SP2E2	1SP3E1 1SP2E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 1SP3E2
				Evidence	2 3	2 3	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 6	7 6	7 7	7 7	7 7
578	7582	9592097_319	LTP can be induced as early as postnatal day 2 in the rat hippocampus (Durand et al., 1996). |A1:**1SP2E2| |A2:**1SP2E2| |A3:**1SP3E2+| |A4:**1SP3E2+| |A5:**1SP3E2|
				Annotation	1SP2E2	1SP2E2	1SP3E2+	1SP3E2+	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	6	6	7	7	7
579	3301	12006406_6	Separate multipoint fine-mapping of this locus with independent markers replicated the linkage results (lod 2.64). |A1:**1GP3E0| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E1+|
				Annotation	1GP3E0	1SP3E3	1SP3E3	1SP3E3	1SP3E1+
				Evidence	1	4	4	4	2
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
580	9014	11738031_19	Phosphorylated CREB (pCREB), together with a CREB binding protein, which serves as a transcriptional coactivator, |A3:**1SP3E0| |A4:**1SP3E0| regulates transcription for a large class of genes and has been implicated in learning and memory (Silva et al., 1998; Josselyn et al., 2001 ). |A3:**2SP3E2| |A1:**1SP3E2| |A2:**1SP3E2| |A4:**2SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E0 2SP3E2	1SP3E0 2SP3E2	1SP3E2 1SP3E2
				Evidence	3 3	3 3	1 3	1 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
581	8651	9456323_81	CHO-orf4-7 cells were incubated in the presence of 1 mug/ml doxycycline and 50 muM zVAD-fmk for 36 h. Nonadherent and adherent cells were collected, washed in sucrose buffer, and then fixed with 3% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.2-7.4, for 90 min at room temperature. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
582	7717	10428976_379	The beta barrel structure proposed by Mann et al. (33) |A4:**1SP3E2| for betaC:B may be the triacylglycerol-binding domain of hAPOB that accepts "`shuttled"` monomeric triacylglycerol from the beta barrel structure proposed by Mann et al. (33) for the betaC:MTP domain of hMTP. |A1:**1SP1E2| |A2:**1SP2E2| |A3:**1SP2E2| |A4:**2SP2E2| |A5:**1SP3E2|
				Annotation	1SP1E2 1SP1E2	1SP2E2 1SP2E2	1SP2E2 1SP2E2	1SP3E2 2SP2E2	1SP3E2 1SP3E2
				Evidence	3 3	3 3	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	6 6	6 6	7 6	7 7
583	2332	10022929_11	Frequently, the protein-protein interactions are mediated by adapter proteins, a group of noncatalytic proteins specialized in mediating multiprotein complex formation. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP2E0	1SP2E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	6	6	7
584	2088	10545115_287	Thus, we consider it likely that PML and Daxx are transcriptional modulators whose effects on gene expression (up- or downregulation) |A3:**1SP3E3| |A4:**1SP3E3| may vary depending on interactions with other factors or a variety of circumstances. |A3:**2SP2E0| |A1:**1SP1E3| |A2:**1SP3E1| |A4:**2SP2E0| |A5:**1SP3E3|
				Annotation	1SP1E3 1SP1E3	1SP3E1 1SP3E1	1SP3E3 2SP2E0	1SP3E3 2SP2E0	1SP3E3 1SP3E3
				Evidence	4 4	2 2	4 1	4 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	7 7	7 6	7 6	7 7
585	3517	11078735_41	Only marginal activity was observed with guanosine, |A3:**1SP1E3| |A4:**1SP1E3| and neither 2', 3'-dideoxynucleosides nor hypoxanthine arabinoside served as substrates. |A3:**2SN3E3| |A1:**1SP3E3| |A2:**1SP3E3| |A4:**2SN3E3| |A5:**1GP3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP1E3 2SN3E3	1SP1E3 2SN3E3	1GP3E3 1GP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	5 1	5 1	7 7
586	3915	10456878_91	Plasma was collected by centrifugation and stored at 70 degrees C until the day of the assay. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
587	1680	9099694_45	REFERENCES Haritos, A. A., Blacher, R., Stein, S., Caldarella, J., and Horecker, B. L. (1985) Proc. |A1:**1GP3E0| |A2:**1GP3E2| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E2|
				Annotation	1GP3E0	1GP3E2	1SP3E0	1SP3E0	1GP3E2
				Evidence	1	3	1	1	3
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
588	3413	11545071_283	If it turns out that the rodents are most distantly related to the other groups of mammals, |A3:**1SP2E0| |A5:**1GP2E1| then the K associated with H197Y in the ancestral rodent pigment will be >8. |A3:**2SP3E0| |A1:**1SP2E0| |A2:**1SP2E1| |A4:**1SP3E0| |A5:**2GP3E1|
				Annotation	1SP2E0 1SP2E0	1SP2E1 1SP2E1	1SP2E0 2SP3E0	1SP3E0 1SP3E0	1GP2E1 2GP3E1
				Evidence	1 1	2 2	1 1	1 1	2 2
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	6 6	6 6	6 7	7 7	6 7
589	6803	11560910_272	This work was supported in part by grant MCB-9727906 from the National Science Foundation. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP3E0	1SP3E3	1SP3E3	1GP3E0
				Evidence	1	1	4	4	1
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
590	7627	11591658_87	The nucleotide sequences of the R. rubrum glnK and glnJ regions have been deposited in the GenBank database under accession numbers AF207908 and AF329498, respectively. |A1:**1GP3E1| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1GP3E1	1SP3E3	1SP3E3	1SP3E3	1GP3E0
				Evidence	2	4	4	4	1
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
591	4360	10625639_34	Moreover, the UV-visible spectra of the as-isolated proteins are all similar, with copper(II) d-d bands at ~680 nm and shoulders at ~450 nm. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SMP3E3|
				Annotation	1SP3E0	1SP3E0	1SP3E3	1SP3E3	1SMP3E3
				Evidence	1	1	4	4	4
				Focus	4	4	4	4	6
				Polarity	7	7	7	7	7
592	9169	9643348_216	The work described was supported by a National Institutes of Health (NIH) Program Project Grant, HL41633. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP3E0	1SP3E3	1SP3E3	1GP3E0
				Evidence	1	1	4	4	1
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
593	9745	11516955_2	We found that, when cornering, he spent most of the time looking close to, |A3:**1GP2E3| |A4:**1GP2E3| |A5:**1GP3E3| but not exactly at, the tangent points on the inside edges of the bends. |A3:**2GN1E0| |A1:**1GP3E3| |A2:**1GP3E3| |A4:**2GN1E0| |A5:**2GN3E3|
				Annotation	1GP3E3 1GP3E3	1GP3E3 1GP3E3	1GP2E3 2GN1E0	1GP2E3 2GN1E0	1GP3E3 2GN3E3
				Evidence	4 4	4 4	4 1	4 1	4 4
				Focus	1 1	1 1	1 1	1 1	1 1
				Polarity	7 7	7 7	6 3	6 3	7 1
594	591	10978289_247	The mRNA can be detected in the germ cells throughout their migration through the midgut and into the gonadal mesoderm (data not shown) |A1:**1SP2E1| |A2:**1SP2E1| and is present in the embryonic gonad of stage 15 embryos ( Fig 6G). |A1:**2SP3E3| |A2:**2SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP2E1 2SP3E3	1SP2E1 2SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3
				Evidence	2 4	2 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	6 7	6 7	7 7	7 7	7 7
595	7060	10330189_286	We tested whether strong activation could be observed in normal human T lymphocytes (Fig. 7C). |A1:**1SP1E3| |A2:**1SP2E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP3E3|
				Annotation	1SP1E3	1SP2E3	1SP2E3	1SP2E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	5	6	6	6	7
596	1017	12137974_3	AM, ET-1, and NO were detected in all of the follicular fluid samples and their concentrations were similar in spontaneous and stimulated cycles. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
597	594	11861563_9	This novel numb allele, as well as previously described ones, was shown to affect the fly's rhythm of locomotor activity. |A1:**1GP3E3| |A2:**1SP3E1| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1SP3E1|
				Annotation	1GP3E3	1SP3E1	1SP3E1	1SP3E1	1SP3E1
				Evidence	4	2	2	2	2
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
598	1825	12132254_1	In the eyes of the intellectually curious William Gies, dentistry and dental education in 1926 was mechanical, empirical, commercial, reparative, and isolated from other disciplines. |A1:**1GP3E3| |A2:**1GP3E0| |A3:**1SP3E1| |A4:**1GP3E3| |A5:**1GP3E0|
				Annotation	1GP3E3	1GP3E0	1SP3E1	1GP3E3	1GP3E0
				Evidence	4	1	2	4	1
				Focus	1	1	4	1	1
				Polarity	7	7	7	7	7
599	7006	9367983_165	The twofold difference in complex abundance in the presence of TFIID and TFIIA can be compared with the 7-fold and 3.5-fold differences in the strengths of these promoters in vitro and in vivo, respectively (Fig. 1B; Lo and Smale 1996). |A1:**1SP3E3| |A2:**1SP3E2| |A3:**1SP2E2| |A4:**1SP2E2| |A5:**1SP3E2|
				Annotation	1SP3E3	1SP3E2	1SP2E2	1SP2E2	1SP3E2
				Evidence	4	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	6	6	7
600	1105	11438670_1	Two alleles of the Drosophila melanogaster Rfc4 ( DmRfc4) gene, which encodes subunit 4 of the replication factor C (RFC) complex, cause striking defects in mitotic chromosome cohesion and condensation. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E1
				Evidence	1	1	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
601	5312	12074291_3	Following stabilisation, all three cats underwent exploratory surgery. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1GP3E0	1GP3E0	1SP3E0	1SP3E0	1GP3E3
				Evidence	1	1	1	1	4
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
602	4401	10992459_191	Although it is well known that plasmid DNA derived from bacteria acts as a nonspecific adjuvant in the stimulation of a Th1 response ( 31), |A5:**1SP3E2| |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| several lines of evidence indicate that the protection induced by our multicomponent DNA vaccine was not due to a nonspecific immunostimulatory effect of the vector DNA |A5:**2SN3E3| but rather due to immune responses induced by sequences specific to Leishmania. |A5:**3SP3E3| |A1:**2SP3E1| |A2:**2SP3E1| |A3:**2SN3E1| |A4:**2SN3E1|
				Annotation	1SP3E2 2SP3E1 2SP3E1	1SP3E2 2SP3E1 2SP3E1	1SP3E2 2SN3E1 2SN3E1	1SP3E2 2SN3E1 2SN3E1	1SP3E2 2SN3E3 3SP3E3
				Evidence	3 2 2	3 2 2	3 2 2	3 2 2	3 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	7 7 7	7 1 1	7 1 1	7 1 7
603	4666	11238885_218	These data suggest that the physiological state of homozygotes may be normal before and just after birth, but a failure to suckle may contribute to the lethal phenotype. |A1:**1SP1E3| |A2:**1SP3E1| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1SP2E1|
				Annotation	1SP1E3	1SP3E1	1SP2E3	1SP2E3	1SP2E1
				Evidence	4	2	4	4	2
				Focus	4	4	4	4	4
				Polarity	5	7	6	6	6
604	4157	9298899_246	All data were integrated and scaled with DENZO and SCALEPACK (Otwinowski, 1993 ) ( Table 1A). |A1:**1GP3E23| |A2:**1GP3E23| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E23|
				Annotation	1GP3E23	1GP3E23	1SP3E3	1SP3E3	1GP3E23
				Evidence	3	3	4	4	3
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
605	1534	10585437_16	In the natural environment, modified bases in M. Jannaschii tRNATyr may help to stabilize the tRNA structure above 73 degrees C (which corresponds to the Tm of the transcript). |A1:**1SP1E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1SP2E0|
				Annotation	1SP1E0	1SP2E0	1SP2E0	1SP2E0	1SP2E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	5	6	6	6	6
606	1813	9813103_186	Distribution of beta1-integrin and actin in cells plated for 30 min on fibronectin. |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1MP3E0|
				Annotation	1SP3E3	1SP3E0	1SP3E0	1SP3E0	1MP3E0
				Evidence	4	1	1	1	1
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
607	9592	12235085_13	After logistic regression, young age (p=0.0008), female sex (p=0.01), long duration of infection (p=0.0001), and HLA DRB1*11 DRB1x11 (p=0.050) were more strongly associated with persistence of normal ALT. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP2E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	6	7	7
608	5757	12431371_173	In contrast, as shown in Figures 4B and 4C, when cultured in the absence of survival factors, BAD+/+ and BAD3SA/3SA MEFs underwent equivalent levels of cell death after treatment with anti-Fas antibodies, TNF, irradiation, or etoposide, |A3:**1MP3E3| |A4:**1MP3E3| as might be expected, |A5:**1SP3E3| as BAD is dephosphorylated in the absence of survival factors in both wild-type and BAD3SA/3SA cells. |A5:**2SP3E3-| |A1:**1SP1E3| |A2:**1SP1E3| |A3:**2SP2E0| |A4:**2SP2E0|
				Annotation	1SP1E3 1SP1E3 1SP1E3	1SP1E3 1SP1E3 1SP1E3	1MP3E3 2SP2E0 2SP2E0	1MP3E3 2SP2E0 2SP2E0	1SP3E3 1SP3E3 2SP3E3-
				Evidence	4 4 4	4 4 4	4 1 1	4 1 1	4 4 4
				Focus	4 4 4	4 4 4	2 4 4	2 4 4	4 4 4
				Polarity	5 5 5	5 5 5	7 6 6	7 6 6	7 7 7
609	8898	10454504_25	We reported recently the pharmacological properties of the FP receptor of Swiss mouse 3T3 fibroblasts (Griffin et al., 1997) and A7r5 rat thoracic aorta vascular smooth muscle cells (Griffin et al., 1998 ). |A3:**1SP3E2| |A1:**1SP3E2| |A2:**1SP3E23| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E23	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
610	5084	9673245_62	The invasiveness of C. jejuni isolates was determined according to the method of Wassenaar et al. (60). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1MP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E2	1SP3E2	1MP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
611	3257	10653722_217	Interestingly, the different bands observed previously were not present in the same cell fractions (Fig. 7). |A1:**1SN3E3| |A2:**1SN3E3| |A3:**1SN3E3| |A4:**1SN3E3| |A5:**1GN3E3|
				Annotation	1SN3E3	1SN3E3	1SN3E3	1SN3E3	1GN3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	1	1	1	1	1
612	1461	9560277_14	Finally, ligand binding studies have reported abnormalities in PFC GABAA receptors in schizophrenia ( 9). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
613	1557	8910317_116	Comm. 12, 661-669 Valle, V. G. R., Fagian, M. M., Parentoni, L. S., Meinicke, A. R., Vercesi, A. E. (1993) Arch. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1GP3E0| |A4:**1GP3E0| |A5:**1GP3E2|
				Annotation	1GP3E0	1GP3E0	1GP3E0	1GP3E0	1GP3E2
				Evidence	1	1	1	1	3
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
614	9664	11713291_66	Clearly, hsp70i affects multiple apoptotic pathways, |A1:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1| and cell type-specific differences may account for the various points of hsp70i intervention. |A1:**2SP1E0| |A2:**1SP2E0| |A3:**2SP2E0| |A4:**2SP2E0| |A5:**2SP2E0|
				Annotation	1SP3E0 2SP1E0	1SP2E0 1SP2E0	1SP3E0 2SP2E0	1SP3E0 2SP2E0	1SP3E1 2SP2E0
				Evidence	1 1	1 1	1 1	1 1	2 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 5	6 6	7 6	7 6	7 6
615	8860	9390512_109	A multi-center collaborative effort (Schizophrenia Collaborative Linkage Group for chromosome 22 1996 ) |A4:**1SP3E2| analyzed genotypings of this marker provided by 11 independent research groups worldwide, |A5:**1SP3E1| by employing an affected sib-pair analysis on a sample of 296 affected sib-pairs, |A5:**2MP3E1| and revealed significant allele sharing by affected individuals for this marker. |A5:**3SP3E1| |A1:**1SP3E3| |A2:**1SP3E2| |A3:**1SP3E1| |A4:**2SP3E3|
				Annotation	1SP3E3 1SP3E3 1SP3E3 1SP3E3	1SP3E2 1SP3E2 1SP3E2 1SP3E2	1SP3E1 1SP3E1 1SP3E1 1SP3E1	1SP3E2 2SP3E3 2SP3E3 2SP3E3	1SP3E1 1SP3E1 2MP3E1 3SP3E1
				Evidence	4 4 4 4	3 3 3 3	2 2 2 2	3 4 4 4	2 2 2 2
				Focus	4 4 4 4	4 4 4 4	4 4 4 4	4 4 4 4	4 4 2 4
				Polarity	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7	7 7 7 7
616	1247	8706137_83	Taken together, the results shown in Figure 3 indicated that both ATP binding and specific DNA |A3:**1SP3E3| |A4:**1SP3E3| (i.e., a sequence bearing the two XylR binding sites in the same face of the DNA helix) are required for optimal multimerization of the activator at the Pu enhancer. |A3:**2SP3E0| |A1:**1SP3E3| |A2:**1SP3E3| |A4:**2SP3E0| |A5:**1SP3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 2SP3E0	1SP3E3 2SP3E0	1SP3E3 1SP3E3
				Evidence	4 4	4 4	4 1	4 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
617	6112	12269295_2	A possible common denominator among disrupted processes is the use of attention. |A1:**1GP3E0| |A2:**1GP1E0| |A3:**1GP2E0| |A4:**1GP2E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP1E0	1GP2E0	1GP2E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	1	1	1	1
				Polarity	7	5	6	6	7
618	3135	11930015_21	Most lipoproteins are expressed in many tissues and cell types, including the brain and cerebrospinal fluid ( 6). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP2E2| |A4:**1SP2E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP2E2	1SP2E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	7
619	9910	9566974_74	Purified recombinant alpha-catenin (0.1 mg/ml in 100 mM NH4HCO3, pH 7.8) was incubated overnight with endoproteinase Glu-C (V8, 25 mug/ml; Boehringer Mannheim GmbH, Mannheim, Germany). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
620	2401	10884434_14	First, four of five imaging studies have documented an increase in the striatal accumulation of [18]fluorodopa or [11]dopa in patients with schizophrenia ( 8-12). |A1:**1GP3E2+| |A2:**1SP3E2+| |A3:**1SP1E2+| |A4:**1SP3E2+| |A5:**1GP3E2+|
				Annotation	1GP3E2+	1SP3E2+	1SP1E2+	1SP3E2+	1GP3E2+
				Evidence	3	3	3	3	3
				Focus	1	4	4	4	1
				Polarity	7	7	5	7	7
621	5266	11083827_202	To confirm the EC7372-induced apoptosis and to quantify the process, we performed flow cytometric experiments. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1GP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	1
				Polarity	7	7	7	7	7
622	6449	11689693_322	Although the molecular mechanisms remain to be characterized, |A5:**1GP3E0| the binding of RhoG to the central coiled coil coiled-coil region of kinectin might elicit structural changes in the whole complex, |A5:**2SP2E0| eventually enhancing kinesin motor activity. |A5:**3SP3E0+| |A1:**1SP1E0| |A2:**1SP1E0| |A3:**1SP3E0| |A4:**1SP2E0|
				Annotation	1SP1E0 1SP1E0 1SP1E0	1SP1E0 1SP1E0 1SP1E0	1SP3E0 1SP3E0 1SP3E0	1SP2E0 1SP2E0 1SP2E0	1GP3E0 2SP2E0 3SP3E0+
				Evidence	1 1 1	1 1 1	1 1 1	1 1 1	1 1 1
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 4 4
				Polarity	5 5 5	5 5 5	7 7 7	6 6 6	7 6 7
623	3317	9763447_297	Therefore, the bright spot(s) were interpreted as mitotic spindle pole bodies. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1GP3E3
				Evidence	4	4	1	1	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
624	1005	11891243_1	Wounding chickpea (Cicer arietinum) internodes or cotyledons resulted in an increase in the steady-state level of copper amine oxidase (CuAO) expression both locally and systemically. |A1:**1SP3E3+| |A2:**1SP3E3+| |A3:**1SP3E1+| |A4:**1SP3E0+| |A5:**1SP3E1+|
				Annotation	1SP3E3+	1SP3E3+	1SP3E1+	1SP3E0+	1SP3E1+
				Evidence	4	4	2	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
625	191	12135986_20	Similarly, in chick embryos, what appeared to be sustained activation of beta-catenin |A5:**1GP2E2| led to excessive feather and scale morphogenesis ( Noramly et al., 1999; Widelitz et al., 2000). |A1:**1SP3E2| |A2:**1SP3E2+| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**2GP3E2+|
				Annotation	1SP3E2 1SP3E2	1SP3E2+ 1SP3E2+	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1GP2E2 2GP3E2+
				Evidence	3 3	3 3	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	6 7
626	6387	9390512_46	Theoretical analyses as well as data from recent molecular genetic studies suggest that high genetic heterogeneity exists in schizophrenia (Risch ( Risch 1994 ; Tsuang and Faraone 1995), 1995 ), |A1:**1SP2E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP2E2| |A5:**1SP3E2| which, unlike Mendelian type Mendelian-type heterogeneity, has the form of overlapping sets of interacting genes predisposing individuals to the same disease. |A1:**2SP3E0| |A2:**2SP3E0| |A3:**2SP3E0| |A4:**2SP3E0| |A5:**2SN3E0|
				Annotation	1SP2E2 2SP3E0	1SP3E2 2SP3E0	1SP3E2 2SP3E0	1SP2E2 2SP3E0	1SP3E2 2SN3E0
				Evidence	3 1	3 1	3 1	3 1	3 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	6 7	7 7	7 7	6 7	7 1
627	4133	9287303_27	Therefore, hydrophobic rather than ionic interactions play an important role in the binding. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E3	1GP3E0
				Evidence	1	1	1	4	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
628	1369	11134330_41	Electrophoretic mobility shift assays (EMSAs) were performed as described elsewhere ( 8). |A1:**1MP3E2| |A2:**1MP3E2| |A3:**1MP3E2| |A4:**1MP3E2| |A5:**1MP3E23|
				Annotation	1MP3E2	1MP3E2	1MP3E2	1MP3E2	1MP3E23
				Evidence	3	3	3	3	3
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
629	6326	10725337_359	Cytokeratin disassembly was primarily mediated by effector caspases, as these inclusions were larger and more pronounced in MCF-7 cells in the presence of exogenously expressed caspases-3 or -7. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E1-| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E1-	1SP3E0	1SP3E1
				Evidence	4	4	2	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
630	7340	9252397_30	Fig. 3. Repair of UV-induced cyclobutane pyrimidine dimers along the promoter and transcription initiation site of the human JUN gene in normal human fibroblasts. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1MP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	2	4	4	4	4
				Polarity	7	7	7	7	7
631	3739	11923448_17	Other evidence of molecular and electrophysiological changes in the medial prefrontal cortex of these animals supports this interpretation (Bertolino et al., 1999 ; O'Donnell et al., 1999 ; Stine et al., 2001). |A1:**1SP2E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP2E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	6	7	7	7	7
632	3195	7657661_13	Lysates containing the wild type and the mutant B-crystallin were run on 12% gel. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
633	5374	12438416_256	In contrast, the 75- and 50-kD fragments were detected only in vitro (Fig. 3) |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1SP3E3| and no immunoreactive species of these sizes were observed in vivo using any of the p115 antibodies. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**2MN3E1| |A4:**2MN3E3| |A5:**2SN3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1MP3E3 2MN3E1	1MP3E3 2MN3E3	1SP3E3 2SN3E3
				Evidence	4 4	4 4	4 2	4 4	4 4
				Focus	4 4	4 4	2 2	2 2	4 4
				Polarity	7 7	7 7	7 1	7 1	7 1
634	3633	9802880_101	The hybridization buffer contained 0.6 M NaCl, 1 mM EDTA, 10 mM Tris-HCl (pH 7.5), 0.25% SDS, 200 mug/ml yeast tRNA, 1x Denhardt's solution, 10% dextran sulfate, 40% formamide, and 100 ng/ml of the indicated digoxigenin-labeled riboprobe. |A1:**1MP3E0| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E0	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	1	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
635	2805	10653739_111	Cell numbers determined for individual production wells were highly variable, depending upon the sampling date and origin of the samples. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E3	1SP3E3	1SP3E0	1SP3E0	1GP3E0
				Evidence	4	4	1	1	1
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
636	6055	9575187_274	Prior studies have shown that enzymatic processing of APP is altered in AD |A5:**1GP3E1| such that there is reduced cleavage at the alpha-secretase site |A5:**2SP3E1-| |A1:**1SP3E1-| |A2:**1SP3E1-| |A3:**1SP3E2-| |A4:**1SP3E2-| and increased cleavage at the beta- and gamma-secretase sites (for a review, see Refs. |A5:**3SP3E2+| |A1:**2SP3E1+| |A2:**2SP2E2+| |A3:**2SP3E3+| |A4:**2SP3E3+|
				Annotation	1SP3E1- 1SP3E1- 2SP3E1+	1SP3E1- 1SP3E1- 2SP2E2+	1SP3E2- 1SP3E2- 2SP3E3+	1SP3E2- 1SP3E2- 2SP3E3+	1GP3E1 2SP3E1- 3SP3E2+
				Evidence	2 2 2	2 2 3	3 3 4	3 3 4	2 2 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 4 4
				Polarity	7 7 7	7 7 6	7 7 7	7 7 7	7 7 7
637	7189	9763456_267	Thus, Box C'' is not equivalent to Box C either in sequence or as a NoLE. |A1:**1GN3E0| |A2:**1GN3E0| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1GN3E1|
				Annotation	1GN3E0	1GN3E0	1SN3E0	1SN3E0	1GN3E1
				Evidence	1	1	1	1	2
				Focus	1	1	4	4	1
				Polarity	1	1	1	1	1
638	7851	8550627_128	To test that cross-linking was just intramolecular and did not generate any artifactual binding of labeled rhodanese, |A5:**1SN3E3| GroEL was incubated with native rhodanese instead of denatured rhodanese. |A5:**2MP3E3| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP2E1| |A4:**1SP2E2-|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP2E1 1SP2E1	1SP2E2- 1SP2E2-	1SN3E3 2MP3E3
				Evidence	4 4	4 4	2 2	3 3	4 4
				Focus	4 4	4 4	4 4	4 4	4 2
				Polarity	7 7	7 7	6 6	6 6	1 7
639	1270	12125911_3	We have previously reported that the tyrosine kinase activity of c-Src belonging to the Src family kinase is increased together with altered tyrosine phosphorylation of several cellular proteins in the in vitro model of decidualization. |A1:**1SP3E1+| |A2:**1SP3E1+| |A3:**1SP3E1+| |A4:**1SP3E3+| |A5:**1SP3E1+|
				Annotation	1SP3E1+	1SP3E1+	1SP3E1+	1SP3E3+	1SP3E1+
				Evidence	2	2	2	4	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
640	4864	10878041_11	H. pullorum is now known to colonize many chicken flocks and is commonly isolated from the cecal contents and carcasses of slaughtered chickens ( 1, 2). |A1:**1GP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1GP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
641	6405	10966427_147	Thus, while the E. coli pyk mutant cannot convert PEP to pyruvate via PYK activity, |A1:**1SN2E0| |A2:**1SN3E0| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1SN3E1| PEP can enter the trichloroacetic acid cycle via PEP carboxylase activity (PEP to oxaloacetate). |A1:**2SP2E0| |A2:**2SP3E0| |A3:**2SP3E0| |A4:**2SP3E0| |A5:**2SP3E0|
				Annotation	1SN2E0 2SP2E0	1SN3E0 2SP3E0	1SN3E0 2SP3E0	1SN3E0 2SP3E0	1SN3E1 2SP3E0
				Evidence	1 1	1 1	1 1	1 1	2 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	2 6	1 7	1 7	1 7	1 7
642	2540	9520407_49	Numerals 1 and 30 correspond to the numbering of native tRNA. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
643	4331	10391869_55	The chi2 test was used in the data analysis of the in vivo protective effects of pentoxifylline. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E1| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E1	1SP3E0	1MP3E3
				Evidence	4	4	2	1	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
644	7521	10454382_99	All HU flies were subjected to paraffin histology after the behavioral experiment. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E1| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E1	1SP3E0	1MP3E3
				Evidence	4	4	2	1	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
645	9661	10207001_23	However, questions still remain as to whether the E2 transactivator functions within nuclear speckles and whether the speckle pattern of E2 expression is critical for E2's function in facilitating splicing. |A1:**1SP0E0| |A2:**1SP1E0| |A3:**1SP3E0| |A4:**1SP2E0| |A5:**1SP1E0|
				Annotation	1SP0E0	1SP1E0	1SP3E0	1SP2E0	1SP1E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	4	5	7	6	5
646	6918	9663388_6	Newly forming ER tubules extended only in a microtubule plus-end direction towards the cell periphery: |A5:**1SP3E3| 31.4% by TACs and 68.6% by the membrane sliding mechanism. |A5:**2MP3E3| |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E3| |A4:**1MP3E3|
				Annotation	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E3 1SP3E3	1MP3E3 1MP3E3	1SP3E3 2MP3E3
				Evidence	1 1	1 1	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	2 2	4 2
				Polarity	7 7	7 7	7 7	7 7	7 7
647	5718	9396787_59	The 125I-labeled material was synthesized at Amersham (Arlington Heights, IL) using the same starting peptide and radioactive Bolton-Hunter reagent. |A1:**1GP3E3| |A2:**1MP3E3| |A3:**1SP3E1| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1GP3E3	1MP3E3	1SP3E1	1SP3E3	1MP3E3
				Evidence	4	4	2	4	4
				Focus	1	2	4	4	2
				Polarity	7	7	7	7	7
648	8072	11278665_3	Here we determine that similar mechanisms are operational in regulating the apoptotic signaling of other death receptors. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
649	2679	12871907_278	The values of their major axes (in micrometers) and fluorescence intensities (rfiu; relative fluorescent intensity unit) are arranged in a scatter plot in Fig 9. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
650	4	9425154_262	There, syntaxin was shown to suffice for alpha-SNAP binding. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E1	1SP3E1	1SP3E1	1GP3E1
				Evidence	4	2	2	2	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
651	7870	10801849_83	Control lanes 1, 2, 7, and 8 were as in A. |A5:**1GP3E3| C, in vitro translated p59 was mixed with in vitro translated p17 ( lane 4), p12 ( lane 5), or p17 and p12 ( lane 6). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**2MP3E3|
				Annotation	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1GP3E3 2MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	2 2	2 2	1 2
				Polarity	7 7	7 7	7 7	7 7	7 7
652	4587	12095722_1	In order to determine which technical aspects of the Austin Moore hemiarthroplasty procedure affect the outcome, we reviewed 243 patients with a non-pathological intracapsular femoral neck fracture who had, Austin Moore uncemented hemiarthroplasty. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	1	4	4	4	2
				Polarity	7	7	7	7	7
653	9636	11029439_54	Mutants were grown in broth in the absence of chloramphenicol to allow loss of the resident pVJT128 plasmid, as described previously (38). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E2-| |A4:**1SP3E2-| |A5:**1MP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E2-	1SP3E2-	1MP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
654	8610	9763432_98	Whereas the inhibitor did not significantly influence recovery of total BAX associated with mitochondria (Fig. 2 C, lanes 3 and 4), |A2:**1SN3E3| |A3:**1SN3E3| |A4:**1SN3E3| |A5:**1SN3E3| it reduced the amount of alkaline-resistant membrane-integrated BAX |A1:**1SN3E3-| that was recovered with the organelle (Fig. 2 C, lanes 7 and 8). |A1:**2SP3E3+| |A2:**2SP3E3-| |A3:**2SP3E3-| |A4:**2SP3E3-| |A5:**2SP3E3-|
				Annotation	1SN3E3- 1SN3E3- 2SP3E3+	1SN3E3 2SP3E3- 2SP3E3-	1SN3E3 2SP3E3- 2SP3E3-	1SN3E3 2SP3E3- 2SP3E3-	1SN3E3 2SP3E3- 2SP3E3-
				Evidence	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	1 1 7	1 7 7	1 7 7	1 7 7	1 7 7
655	6257	10966383_227	It is noteworthy that the enzyme is quite stable even in 8 M urea, which causes complete denaturation of ordinary proteins. |A1:**1SP3E0| |A2:**1SP3E0-| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E0	1SP3E0-	1SP3E0	1SP3E3	1SP3E3
				Evidence	1	1	1	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
656	4205	9447995_293	It was observed that XAP2 was present in the 9S form under these new conditions (Fig. 8B and E). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
657	122	9407036_28	Additionally, maximal induction of the PMR2A/ENA1 gene |A4:**1SP3E0+| in response to high environmental salt requires calcineurin activation by Ca2+/calmodulin (Garciadeblas et al. 1993; Cunningham and Fink 1996 ). |A4:**2SP3E2+| |A1:**1SP3E2| |A2:**1SP3E2+| |A3:**1SP3E2+| |A5:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2+ 1SP3E2+	1SP3E2+ 1SP3E2+	1SP3E0+ 2SP3E2+	1SP3E2 1SP3E2
				Evidence	3 3	3 3	3 3	1 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
658	6755	9169478_14	p21 ras, which is activated by IL-2 ( , ), has also been suggested as a proximal activator for the kinase ( ). |A1:**1SP3E2| |A2:**1SP3E2+| |A3:**1SP2E0| |A4:**1SP2E1| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2+	1SP2E0	1SP2E1	1SP3E2
				Evidence	3	3	1	2	3
				Focus	4	4	4	4	4
				Polarity	7	7	6	6	7
659	321	9837930_186	Noteworthy is that the majority of beta-cells oscillate at the control glucose concentration of 11 mM. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E1
				Evidence	1	1	1	1	2
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
660	3827	0009835588_22	Traditional plating techniques commonly result in assessment of the diversity of less than 10% of the total bacterial community present (23, 29). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1MP3E3	1MP3E3	1GP3E2
				Evidence	3	3	4	4	3
				Focus	4	4	2	2	1
				Polarity	7	7	7	7	7
661	1592	10985343_206	Scanning the specimens either sequentially or simultaneously using the three excitation lines in the krypton-argon laser (488 nm for DiO, 568 nm for DiI, and 647 nm for DiD) with three separate barrier filter sets (522 plus-or-minus 35 nm for DiO, 580 plus-or-minus 32 nm for DiI, and 680 plus-or-minus 32 nm for DiD) gave good separation of the three image planes. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E0	1SP3E0	1MP3E3	1MP3E3	1MP3E3
				Evidence	1	1	4	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
662	2283	12058018_193	Yet the cta4-null mutant displayed pleiotropic cellular phenotypes. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E3	1SP3E1	1SP3E0	1SP3E0	1SP3E1
				Evidence	4	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
663	756	11248093_29	We also show that DCC recruits caspase-3 and caspase-9, resulting in the activation of caspase-3 via caspase-9. |A1:**1SP3E3+| |A2:**1SP3E3+| |A3:**1SP3E3+| |A4:**1SP3E3+| |A5:**1SP3E3+|
				Annotation	1SP3E3+	1SP3E3+	1SP3E3+	1SP3E3+	1SP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
664	5145	12473692_221	Other crest derivatives such as sympathetic ganglia (sg), the enteric nervous system (ENS), and Schwann cell precursors along peripheral nerves (sp) form independently of beta-catenin activity. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
665	5422	9566919_25	IkappaB proteins sequester these transcription factors in the cytoplasm |A5:**1SP3E2| and inhibit their DNA binding (reviewed in references 6, 8, and 28). |A5:**2SP3E2-| |A1:**1SN3E2| |A2:**1SP3E2-| |A3:**1SP3E3-| |A4:**1SP3E3-|
				Annotation	1SN3E2 1SN3E2	1SP3E2- 1SP3E2-	1SP3E3- 1SP3E3-	1SP3E3- 1SP3E3-	1SP3E2 2SP3E2-
				Evidence	3 3	3 3	4 4	4 4	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	7 7	7 7	7 7	7 7
666	6518	10531276_100	Then the coverslips were transferred to a 24-well plate. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
667	2203	10966423_126	When in log-phase growth, the mutant is more resistant than the parent strain to H2O2 and tBOOH killing, |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E2| but not to MD killing (6). |A3:**2SN3E2| |A1:**1SP3E2| |A2:**1SP3E2| |A4:**2SN3E2| |A5:**2SN3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E0 2SN3E2	1SP3E0 2SN3E2	1SP3E2 2SN3E2
				Evidence	3 3	3 3	1 3	1 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 1	7 1	7 1
668	2536	11160439_14	Targeting of neuropeptide neuromodulator systems capable of concomitantly regulating all affected transmitter systems |A3:**1SP3E0| |A4:**1SP3E0| may therefore be a promising approach for the development of increasingly effective and side-effect-free antipsychotic drugs. |A3:**2SP2E0+| |A1:**1SP1E0| |A2:**1SP2E0| |A4:**2SP2E0+| |A5:**1SP3E1|
				Annotation	1SP1E0 1SP1E0	1SP2E0 1SP2E0	1SP3E0 2SP2E0+	1SP3E0 2SP2E0+	1SP3E1 1SP3E1
				Evidence	1 1	1 1	1 1	1 1	2 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	6 6	7 6	7 6	7 7
669	5055	9362059_60	To detect the long C-strands from newly synthesized telomeres |A5:**1SP3E3| but not the shorter mature macronuclear telomeres, |A5:**2SN3E3| |A3:**1SN3E0| |A4:**1SN3E0| the filters were hybridized overnight with a 5 end-labeled 64-base oligonucleotide (G4T4)8 at 46 degrees C in 400 mM NaCl, 10 mM Tris, pH 8.0, 1 mM EDTA, 50% formamide, 0.1% SDS, and 5x Denhardt's solution. |A5:**3MP3E3| |A1:**1MP3E3| |A2:**1MP3E3| |A3:**2MP3E3| |A4:**2MP3E3|
				Annotation	1MP3E3 1MP3E3 1MP3E3	1MP3E3 1MP3E3 1MP3E3	1SN3E0 1SN3E0 2MP3E3	1SN3E0 1SN3E0 2MP3E3	1SP3E3 2SN3E3 3MP3E3
				Evidence	4 4 4	4 4 4	1 1 4	1 1 4	4 4 4
				Focus	2 2 2	2 2 2	4 4 2	4 4 2	4 4 2
				Polarity	7 7 7	7 7 7	1 1 7	1 1 7	7 1 7
670	4449	10618246_209	Although many factors may affect the growth of specific bacteria at different root locations, |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP3E0| plant iron nutritional status explained approximately 20 to 40% of the total variation in community structure at all of the root locations that were sampled. |A3:**2MP3E3| |A1:**1GP3E3| |A2:**1SP3E3| |A4:**2MP3E3| |A5:**2GP3E1|
				Annotation	1GP3E3 1GP3E3	1SP3E3 1SP3E3	1SP2E0 2MP3E3	1SP2E0 2MP3E3	1GP3E0 2GP3E1
				Evidence	4 4	4 4	1 4	1 4	1 2
				Focus	1 1	4 4	4 2	4 2	1 1
				Polarity	7 7	7 7	6 7	6 7	7 7
671	6574	12136945_5	In the patients with malignant lymphoma, parallel changes in serum sIL-2R and urine neopterin were observed. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
672	6764	9573050_80	Gels were blotted and probed with anti lambda repressor anti-lambda-repressor antibody. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
673	1028	9696748_41	LPS and OmpA may thus be contributed by the recipient cell to the electron-dense region mentioned above |A5:**1SP3E3| and are postulated to act as receptors during conjugation. |A5:**2SP2E3| |A1:**1SP1E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP2E3|
				Annotation	1SP1E0 1SP1E0	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1SP2E3 1SP2E3	1SP3E3 2SP2E3
				Evidence	1 1	1 1	1 1	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	6 6	6 6	6 6	7 6
674	8848	9472020_312	The presence of HCR did not affect binary complex formation. |A1:**1GN3E0| |A2:**1SN3E0| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1GN3E0|
				Annotation	1GN3E0	1SN3E0	1SN3E0	1SN3E0	1GN3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	1	1	1	1	1
675	9850	12139595_1	BACKGROUND: Nitric oxide (NO), when inhaled, has a synergistic effect with airway recruitment strategies such as positive endexpiratory pressure (PEEP) or continuous positive airway pressure (CPAP) in improving oxygenation in lung injury. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
676	4522	10617567_12	A requirement for Wnt3a in the specification of trunk and tail paraxial somitic mesoderm fates has been demonstrated by mutant analyses. |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E1| |A4:**1SP3E3| |A5:**1GP3E1|
				Annotation	1SP3E1	1SP3E1	1SP3E1	1SP3E3	1GP3E1
				Evidence	2	2	2	4	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
677	8725	11133470_80	The highest percentages were detected in the upper layers (0- to 3.25-cm depth). |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E3	1GP3E3	1GP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
678	6453	10583997_148	Commercial RNA from Saccharomyces cerevisiae (Boehringer Mannheim, Meylan, France) |A4:**1SP3E3| was diluted in phosphate buffer (pH 7.1) and added to the sieved and dried soil samples (2 ml g of soil 1) to final concentrations of 20, 50, and 100 mg of RNA g (dry weight) of soil 1. |A4:**2MP3E3| |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1SP3E3 2MP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	2 2	4 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
679	56	12895418_291	The Nodal signaling pathway has conserved roles in regulating asymmetry and laterality throughout vertebrates (Hamada et al., 2002; Boorman and Shimeld, 2002). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
680	2129	9323141_159	AlF4 did not significantly affect velocity or directionality of movement of TCs. |A1:**1SN3E0| |A2:**1SN3E0| |A3:**1SN2E0| |A4:**1SN3E0| |A5:**1GN3E0|
				Annotation	1SN3E0	1SN3E0	1SN2E0	1SN3E0	1GN3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	1	1	2	1	1
681	3463	11287180_223	Frzb-1, for example, coimmunoprecipitates with Wnt-5A, |A5:**1GP3E1| suggesting that it interacts with the Wnt protein, |A5:**2GP2E0| |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP2E0| |A4:**1SP2E0| but it does not block Wnt-5A signaling in a Xenopus functional assay for Wnt-mediated axis duplication. |A5:**3SN3E0| |A1:**2SN3E0| |A2:**2SN3E0| |A3:**2SN3E0| |A4:**2SN3E0|
				Annotation	1SP3E0 1SP3E0 2SN3E0	1SP3E0 1SP3E0 2SN3E0	1SP2E0 1SP2E0 2SN3E0	1SP2E0 1SP2E0 2SN3E0	1GP3E1 2GP2E0 3SN3E0
				Evidence	1 1 1	1 1 1	1 1 1	1 1 1	2 1 1
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 4
				Polarity	7 7 1	7 7 1	6 6 1	6 6 1	7 6 1
682	2630	12020667_1	In the animal kingdom, species-specific differences with regard to the absorption of intact carotenoids are observed. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E3| |A5:**1GP3E1|
				Annotation	1SP3E0	1SP3E1	1SP3E0	1SP3E3	1GP3E1
				Evidence	1	2	1	4	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
683	452	9501077_32	Significant local structural changes may occur when Gag is cleaved, |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1SP2E0| particularly given the dramatic global changes that accompany viral maturation. |A3:**2SP3E0| |A1:**1SP1E0| |A2:**1SP2E0| |A4:**2SP3E0| |A5:**2SP3E0|
				Annotation	1SP1E0 1SP1E0	1SP2E0 1SP2E0	1SP2E0 2SP3E0	1SP2E0 2SP3E0	1SP2E0 2SP3E0
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	6 6	6 7	6 7	6 7
684	8408	12408808_227	Heterozygous siblings (F) and talin mutant (G) embryos are stained for the germ cell marker vasa (green; arrows show germ cells; yolk autofluorescence is also green), F-actin (red), and fasciclin 3 (blue). |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E1	1SP3E1	1MP3E3	1MP3E3	1MP3E3
				Evidence	2	2	4	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
685	8452	11181754_138	In previous studies, we attributed the increase in triglycerides in apoA-II-Tg mice to their functional LCAT deficiency (4) (5) (6). |A3:**1SP3E2+| |A1:**1SP3E2+| |A2:**1SP3E23+| |A4:**1SP3E2+| |A5:**1SP3E2|
				Annotation	1SP3E2+	1SP3E23+	1SP3E2+	1SP3E2+	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
686	8965	12022468_7	In this review, we focus on these novel roles of synapsins during the early stages of development. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
687	8828	8702594_96	Cell extracts of MC58 (L3 immunotype strain phi3) and the lgt B mutant were used in glycosyltransferase assays with FCHASE-aminophenyl-beta-GlcNAc as an acceptor molecule. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
688	6177	9729523_44	Throughout, the data are expressed as means plus-or-minus standard deviations consistently. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E1	1GP3E3	1GP3E3	1GP3E1
				Evidence	4	2	4	4	2
				Focus	4	4	1	1	1
				Polarity	7	7	7	7	7
689	1841	9671478_271	In the future, the simplicity of the reaction system could facilitate isolation of a synaptic complex by gel shift or identification of contact sites between the RAG proteins and DNA by UV cross-linking. |A1:**1SP2E0| |A2:**1SP1E0| |A3:**1MP2E3| |A4:**1MP2E3| |A5:**1GP3E0|
				Annotation	1SP2E0	1SP1E0	1MP2E3	1MP2E3	1GP3E0
				Evidence	1	1	4	4	1
				Focus	4	4	2	2	1
				Polarity	6	5	6	6	7
690	6811	9211885_40	A good correlation was observed between growth rate of clones in the presence of the drug and the presence of Leu or Ile in the third position and a hydrophobic amino acid at the C terminus of the peptide. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E1| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E1	1SP3E3	1GP3E3
				Evidence	4	4	2	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
691	401	12068020_27	The thrombin-thrombomodulin interaction can therefore be used as an instructive model system for illustrating the role of hot spots in protein-protein interactions |A1:**1SP1E0| and to dissect the structural origin of residue-residue coupling in epitopes involved in protein recognition. |A1:**2SP1E0| |A2:**1SP2E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP1E0 2SP1E0	1SP2E0 1SP2E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E1 1SP3E1
				Evidence	1 1	1 1	1 1	1 1	2 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	6 6	7 7	7 7	7 7
692	1289	10555146_268	These data provide novel evidence for the intricate regulation of VE-cadherin function by the extracellular SPP receptors EDG-1 and EDG-3. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E1|
				Annotation	1SP3E0	1SP3E1	1SP3E3	1SP3E3	1SP3E1
				Evidence	1	2	4	4	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
693	9184	12667443_350	Thus, tumor-derived mutations might represent double-hits by concomitantly abrogating the transcriptional and mitochondrial apoptotic activity of p53. |A1:**1SP1E0| |A2:**1SP1E0| |A3:**1SP1E0-| |A4:**1SP2E0| |A5:**1SP2E1|
				Annotation	1SP1E0	1SP1E0	1SP1E0-	1SP2E0	1SP2E1
				Evidence	1	1	1	1	2
				Focus	4	4	4	4	4
				Polarity	5	5	5	6	6
694	7150	9927430_207	Measurements were made using a 1 mm pathlength cell and data analyzed using the JASCO software. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	4	2
				Polarity	7	7	7	7	7
695	7160	9560393_131	Three of the 54 revertants isolated at 30 degrees, and both revertants isolated at 36 degrees, contained dominant suppressors. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MGP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MGP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	3
				Polarity	7	7	7	7	7
696	2634	12045187_188	Consistent with our results, |A5:**1GP3E3| nuclear PML structures are essential for TNFalpha-mediated death (Wang et al., 1998), |A1:**1SP3E2| |A2:**1SP3E23| and PML has been linked to both caspase-dependent and -independent death pathways ( Wang et al. , 1998; Quignon et al. , 1998). |A1:**2SP3E2| |A2:**2SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**2SP3E2|
				Annotation	1SP3E2 1SP3E2 2SP3E2	1SP3E23 1SP3E23 2SP3E2	1SP3E2 1SP3E2 1SP3E2	1SP3E2 1SP3E2 1SP3E2	1GP3E3 2SP3E2 2SP3E2
				Evidence	3 3 3	3 3 3	3 3 3	3 3 3	4 3 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 4 4
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
697	5832	11136978_100	Dynamic studies of PI3K and N-Ras indicate both rapid association and dissociation of the two proteins (Figure 2B). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
698	4658	9539423_136	UT6-b detects sequences that were present in most of the chromosomes in the two U. maydis strains tested. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A4:**1SP3E3| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E3	1SP2E3	1SP3E3	1GP3E1
				Evidence	4	4	4	4	2
				Focus	4	4	4	4	1
				Polarity	7	7	6	7	7
699	5684	10788451_67	Ca2+ was washed off between the two applications, and 200 muM taurolithocholate was perfused for 1 min. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
700	130	9315549_11	In-hospital mortality rates declined during the period from 1993 through 1995 and were lower than predicted |A5:**1GP3E0-| despite the increase in risk. |A5:**2GP3E0+| |A1:**1GP3E3-| |A2:**1GP2E3-| |A3:**1SP3E0-| |A4:**1GP3E0-|
				Annotation	1GP3E3- 1GP3E3-	1GP2E3- 1GP2E3-	1SP3E0- 1SP3E0-	1GP3E0- 1GP3E0-	1GP3E0- 2GP3E0+
				Evidence	4 4	4 4	1 1	1 1	1 1
				Focus	1 1	1 1	4 4	1 1	1 1
				Polarity	7 7	6 6	7 7	7 7	7 7
701	7790	12051669_2	Their model implied that the weighted average of the chemical shifts of the beta-P (MgADP) for S1-bound MgADP asymptotically approaches a high temperature limit. |A1:**1SP3E1| |A2:**1SP3E1+| |A3:**1SP3E3+| |A4:**1SP3E3+| |A5:**1SP3E1|
				Annotation	1SP3E1	1SP3E1+	1SP3E3+	1SP3E3+	1SP3E1
				Evidence	2	2	4	4	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
702	9018	0010224003_59	The filters were rinsed once with 5 ml of the corresponding growth medium, which was maintained at 30 degrees C. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
703	8015	9679052_34	It is hypothesized that part of the signal transduction pathway involves the stimulation of stretch-activated ion channels/carriers that are activated by the gravity stimulus (Sievers et al. 1991). |A1:**1SP2E2| |A2:**1SP2E2| |A3:**1SP2E2+| |A4:**1SP2E2+| |A5:**1SP2E2|
				Annotation	1SP2E2	1SP2E2	1SP2E2+	1SP2E2+	1SP2E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	6	6	6	6	6
704	5947	11904424_26	In epithelial and endothelial cells, integrin ligation regulates cell survival such that detachment from the ECM rapidly induces apoptosis (17, 18). |A1:**1SP3E2| |A2:**1SP3E2+| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2+|
				Annotation	1SP3E2	1SP3E2+	1SP3E2	1SP3E2	1SP3E2+
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
705	6852	9539738_26	The E2 protein is phosphorylated in its central hinge region |A1:**1SP3E3| |A2:**1SP2E0| and previous studies showed that |A3:**1SP3E2| |A4:**1SP3E2| at least one of the phosphorylation sites was critical for transformation functions (ref. 11 and Fig. 1). |A1:**2SP3E23| |A2:**2SP3E23| |A3:**2SP3E3| |A4:**2SP3E3| |A5:**1SP3E2|
				Annotation	1SP3E3 2SP3E23 2SP3E23	1SP2E0 2SP3E23 2SP3E23	1SP3E2 1SP3E2 2SP3E3	1SP3E2 1SP3E2 2SP3E3	1SP3E2 1SP3E2 1SP3E2
				Evidence	4 3 3	1 3 3	3 3 4	3 3 4	3 3 3
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	6 7 7	7 7 7	7 7 7	7 7 7
706	5174	9649502_256	p53A cells were transfected transiently with 10 mug of pCEP4-myc-LA(1-406) by electroporation |A3:**1MP3E3| |A4:**1MP3E3| to detect transient expression of a lamin fragment as a control protein (Rao et al. 1996). |A3:**2SP3E2| |A1:**1SP3E23| |A2:**1MP3E23| |A4:**2SP3E2| |A5:**1MP3E2|
				Annotation	1SP3E23 1SP3E23	1MP3E23 1MP3E23	1MP3E3 2SP3E2	1MP3E3 2SP3E2	1MP3E2 1MP3E2
				Evidence	3 3	3 3	4 3	4 3	3 3
				Focus	4 4	2 2	2 4	2 4	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
707	1491	9539806_93	Likewise, juvenile sensory neurons had a mean action potential duration (1.48 msec +/ 0.1), |A5:**1SP3E3| which was not significantly different from the duration of the adult action potential (mean = 1.44 +/ 0.2). |A5:**2SN3E3| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 2SN3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 1
708	9386	11438668_397	Modulation of Wnt signaling by Axin and Axil. |A1:**1SP2E0| |A2:**1SP2E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP2E0	1SP2E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	6	6	7	7	7
709	4743	10557338_14	The efficacy of these drugs in treating positive symptoms of schizophrenia (such as hallucinations and delusions) is highly correlated with their affinity for postsynaptic dopamine (D2) receptors (1), |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E2| suggesting that psychotic symptoms might be caused by excessive dopaminergic effects or hyperdopaminergia (2). |A3:**2SP2E3| |A1:**1SP1E2| |A2:**1SP3E2| |A4:**2SP2E3| |A5:**2SP2E2|
				Annotation	1SP1E2 1SP1E2	1SP3E2 1SP3E2	1SP3E3 2SP2E3	1SP3E3 2SP2E3	1SP3E2 2SP2E2
				Evidence	3 3	3 3	4 4	4 4	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	5 5	7 7	7 6	7 6	7 6
710	48	9390512_19	Second, twin studies comparing the concordance for schizophrenia in monozygotic (MZ) twin pairs (who, in principle, share all of their genes) with the concordance in dizygotic (DZ) twin pairs (who share half of their genes) |A5:**1SP3E3| demonstrated that the MZ concordance rate (46%-48%) is significantly higher than the DZ rate (4%-14%). |A5:**2SP3E3+| |A1:**1GP3E1| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3|
				Annotation	1GP3E1 1GP3E1	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 2SP3E3+
				Evidence	2 2	4 4	4 4	4 4	4 4
				Focus	1 1	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
711	1213	11238224_132	In contrast to RNA studies, antimicrobial peptides were also found in phagocytes (i.e., alveolar macrophages) and lymphocytes. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1SP3E1
				Evidence	4	4	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
712	9344	8706137_179	Multimer formation is catalyzed by the DNA of the region that bears two phased binding sites. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E3	1SP3E1	1SP3E0	1SP3E0	1SP3E0
				Evidence	4	2	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
713	7548	11010904_168	This result emphasizes further the importance of optimizing production of SAT and cysteine desulfhydrase. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E0	1SP3E0	1SP3E3	1SP3E3	1SP3E3
				Evidence	1	1	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
714	8950	10787438_182	Transfer of stearate caused a fast decline of intrinsic fluorescence of BSA |A2:**1SP3E1-| |A3:**1SP3E0-| |A4:**1SP3E0-| |A5:**1SP3E3-| and reached, in contrast to heptafluorostearate, the final equilibrium within 3 min (Fig 8A). |A2:**2SP3E3| |A1:**1MP3E3| |A3:**2SP3E3| |A4:**2SP3E3| |A5:**2SP3E3|
				Annotation	1MP3E3 1MP3E3	1SP3E1- 2SP3E3	1SP3E0- 2SP3E3	1SP3E0- 2SP3E3	1SP3E3- 2SP3E3
				Evidence	4 4	2 4	1 4	1 4	4 4
				Focus	2 2	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
715	1776	11086011_253	When Ran-GTP levels were lowered in these extracts, spindle assembly was blocked, |A1:**1SN3E3| |A2:**1SP3E3-| |A5:**1SP3E3-| whereas high Ran-GTP levels promoted formation of spindle structures. |A1:**2SP3E3| |A2:**2SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**2SP3E3+|
				Annotation	1SN3E3 2SP3E3	1SP3E3- 2SP3E3	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E3- 2SP3E3+
				Evidence	4 4	4 4	1 1	1 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 7	7 7	7 7	7 7	7 7
716	1928	9744866_70	While previous studies correlated induced p18 expression and association with CDK4 and CDK6 during in vitro myogenesis and adipogenesis (Franklin and Xiong 1996 ; Phelps and Xiong 1998 ), |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2+| |A4:**1SP3E2+| |A5:**1SP3E2| we did not detect abnormal muscle or adipose development in p18-null animals, |A3:**2SN3E3| |A4:**2SN3E3| This indicates that p18 does not have an essential role in causing cell cycle withdrawal during the differentiation of these two tissues. |A1:**2SN3E3| |A2:**2SN3E3| |A3:**3SN3E0| |A4:**3SN3E0| |A5:**2SN3E3|
				Annotation	1SP3E2 2SN3E3 2SN3E3	1SP3E2 2SN3E3 2SN3E3	1SP3E2+ 2SN3E3 3SN3E0	1SP3E2+ 2SN3E3 3SN3E0	1SP3E2 2SN3E3 2SN3E3
				Evidence	3 4 4	3 4 4	3 4 1	3 4 1	3 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 1 1	7 1 1	7 1 1	7 1 1	7 1 1
717	7605	12464613_1251	Because 12(S) HETE 12(S)HETE had no effect on PI3K signaling (Fig. 4), |A2:**1SP3E3-| |A3:**1SN3E3| |A4:**1SN3E3| |A5:**1SN3E3| these results imply that the synergistic effect of EGF and 12(S) HETE 12( S)HETE on PKCbeta activation requires EGF-dependent signaling through PI3K. |A2:**2SP3E0| |A1:**1SP3E3| |A3:**2SP3E3| |A4:**2SP3E3| |A5:**2SP3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3- 2SP3E0	1SN3E3 2SP3E3	1SN3E3 2SP3E3	1SN3E3 2SP3E3
				Evidence	4 4	4 1	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	1 7	1 7	1 7
718	4939	10567577_150	In control studies, levels of each of the SCAN domain containing GAL4 fusions were shown to be comparable, and the ability of each of the fusions to bind a GAL4 site was similar (data not shown). |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E1	1SP3E1	1SP3E3	1SP3E3	1SP3E3
				Evidence	2	2	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
719	4846	9281602_169	Thus, the ligand binding domain (26, 27) and the intracellular domains of the receptor that control the specificity of linkage to G proteins (28, 29) of mGluRs |A3:**1SP3E2| |A4:**1SP3E2| have little in common with other G protein-coupled receptors. |A3:**2SP3E0| |A1:**1SP3E2| |A2:**1SP3E2| |A4:**2SP3E0| |A5:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E2 2SP3E0	1SP3E2 2SP3E0	1SP3E2 1SP3E2
				Evidence	3 3	3 3	3 1	3 1	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
720	6991	12208670_8	CRH did not have any effect on oestrogen release stimulated by increasing concentrations of IGF-I |A1:**1SN3E3+| |A2:**1SN3E3+| |A3:**1SN3E0+| |A4:**1SN3E0+| |A5:**1SN3E3+| and its suppressive effect on FSH-stimulated oestrogen release was overcome by the addition of low doses of exogenous IGF-I. |A1:**2SP3E3| |A2:**2SP3E3| |A3:**2SP3E0| |A4:**2SP3E0| |A5:**2SP3E3|
				Annotation	1SN3E3+ 2SP3E3	1SN3E3+ 2SP3E3	1SN3E0+ 2SP3E0	1SN3E0+ 2SP3E0	1SN3E3+ 2SP3E3
				Evidence	4 4	4 4	1 1	1 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 7	1 7	1 7	1 7	1 7
721	3244	10506154_25	Tel.: 615-322-4384; Fax: 615-343-3794; E-mail: jackie.corbin@mcmail.vanderbilt.edu. |A1:**1GP3E0| |A2:**1GP3E3| |A3:**1GP3E0| |A4:**1GP3E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP3E3	1GP3E0	1GP3E0	1GP3E0
				Evidence	1	4	1	1	1
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
722	2881	9362061_133	Xyloside was added to the cells during the last 30 min to label newly synthesized [35]GAG chains. |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E23	1SP3E23	1MP3E3	1MP3E3	1MP3E3
				Evidence	3	3	4	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
723	4369	11546819_85	At varying times, hemolysis was determined by pelleting intact erythrocytes and measuring the release of hemoglobin as described under "Experimental Procedures." |A1:**1MP3E3| |A2:**1MP3E3| In an attempt to determine whether the hemolytic potential of bound SLS could be reversed by protease treatment, |A1:**2SP2E3| SLS was bound to sheep erythrocytes at 17 degrees C for 15 min. |A1:**3SP3E3| |A2:**2SP2E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 2SP2E3 3SP3E3	1MP3E3 2SP2E3 2SP2E3	1MP3E3 1MP3E3 1MP3E3	1MP3E3 1MP3E3 1MP3E3	1MP3E3 1MP3E3 1MP3E3
				Evidence	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Focus	2 4 4	2 4 4	2 2 2	2 2 2	2 2 2
				Polarity	7 6 7	7 6 6	7 7 7	7 7 7	7 7 7
724	1331	10611236_68	As shown in Fig. 1, the induction of c- jun and the collagenase gene was very efficient in wild-type cells. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3+| |A4:**1SP3E3+| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3+	1SP3E3+	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
725	2887	10455129_5	Moreover, in such cultures, insulin ( ), GH ( ), glucocorticoids ( ), and amino acid availability ( ) have been widely reported to regulate IGF-I gene expression. |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1SP3E1|
				Annotation	1SP3E2	1SP3E2	1MP3E3	1MP3E3	1SP3E1
				Evidence	3	3	4	4	2
				Focus	4	4	2	2	4
				Polarity	7	7	7	7	7
726	742	11160081_59	The resulting PCR products were individually cloned into pGEM7 using XhoI and NsiI to yield plasmids pEA4 and pVALGOX, respectively. |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1MP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	2	4	4	2
				Polarity	7	7	7	7	7
727	7661	10751396_68	These results suggest that the chromatin organization of both nuc B and A in these cells was not dependent on the GR, |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SN2E3| since cells not expressing the GR (M10) exhibited enzyme cleavage similar to those cells expressing the GR (GR2). |A3:**2SN3E0| |A1:**1SN3E3| |A4:**2SN3E0| |A5:**2SN3E3| View larger version (27K): [in this window] [in a new window] Fig. 5. Nuc B and nuc A exhibit differential restriction endonuclease hypersensitivity. |A3:**3SP3E3| |A1:**2SP3E3| |A2:**1SP3E3| |A4:**3SP3E3| |A5:**3SP3E3|
				Annotation	1SN3E3 1SN3E3 2SP3E3	1SP3E3 1SP3E3 1SP3E3	1SP3E3 2SN3E0 3SP3E3	1SP3E3 2SN3E0 3SP3E3	1SN2E3 2SN3E3 3SP3E3
				Evidence	4 4 4	4 4 4	4 1 4	4 1 4	4 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	1 1 7	7 7 7	7 1 7	7 1 7	2 1 7
728	2060	9162023_2	A good correlation between aromatic amino acid at this position and MAO A-type substrate specificity was seen in trout MAO ( ), |A2:**1SP3E2| |A3:**1SP3E0| |A4:**1SP3E0| which has Phe at this position and properties in substrate specificity and inhibitor sensitivity more like those of mammalian MAO A, |A3:**2SP3E0-| |A4:**2SP3E0-| although it does share a similar extent of homology (about 70%) with both mammalian MAO A and MAO B. B. |A5:**1SP3E2| MAO A has a similar affinity for most substrates with aromatic rings, yet over a 1000-fold difference in the affinity among substrates was observed for MAO B. B. |A1:**1SP3E23| |A3:**3SN3E3| |A4:**3SN3E3| |A5:**2SP3E1| The finding of participation of the aromatic side chain in substrate recognition of MAO A suggests that pi-pi interaction between aromatic rings of substrates and the enzyme plays a major part in their interaction and could explain why MAO A has a similar affinity for aromatic substrates substrates. |A1:**2SP2E0| |A2:**2SP2E3| |A3:**4SP2E3| |A4:**4SP2E3| |A5:**3SP2E3|
				Annotation	1SP3E23 1SP3E23 1SP3E23 1SP3E23 2SP2E0	1SP3E2 2SP2E3 2SP2E3 2SP2E3 2SP2E3	1SP3E0 2SP3E0- 3SN3E3 3SN3E3 4SP2E3	1SP3E0 2SP3E0- 3SN3E3 3SN3E3 4SP2E3	1SP3E2 1SP3E2 1SP3E2 2SP3E1 3SP2E3
				Evidence	3 3 3 3 1	3 4 4 4 4	1 1 4 4 4	1 1 4 4 4	3 3 3 2 4
				Focus	4 4 4 4 4	4 4 4 4 4	4 4 4 4 4	4 4 4 4 4	4 4 4 4 4
				Polarity	7 7 7 7 6	7 6 6 6 6	7 7 1 1 6	7 7 1 1 6	7 7 7 7 6
729	9194	11598069_103	Under both conditions, an increase in LPS-induced TNF-alpha release from MNC was observed with increasing amounts of LBP (Fig. 2); |A1:**1SP3E3+| |A2:**1SP3E3+| |A3:**1SP3E3+| |A4:**1SP3E3+| |A5:**1SP3E3+| no significant difference resulted from the different sequences of LPS and LBP addition (data not shown). |A1:**2SP3E1| |A2:**2SP3E1| |A3:**2SN3E3| |A4:**2SN3E3| |A5:**2SN3E3|
				Annotation	1SP3E3+ 2SP3E1	1SP3E3+ 2SP3E1	1SP3E3+ 2SN3E3	1SP3E3+ 2SN3E3	1SP3E3+ 2SN3E3
				Evidence	4 2	4 2	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 1	7 1	7 1
730	8186	12139595_8	iNO), which was interpreted as the result of progressive dilution with nitrogen. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP2E1| |A4:**1SP2E1| |A5:**1SP3E1|
				Annotation	1SP3E3	1SP3E1	1SP2E1	1SP2E1	1SP3E1
				Evidence	4	2	2	2	2
				Focus	4	4	4	4	4
				Polarity	7	7	6	6	7
731	1606	9605989_112	The paired Student t test was performed to compare the effects of LPS and/or GM-CSF treatments on the production of IL-1beta and TNF-alpha at each time point. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	4	4	4	2
				Polarity	7	7	7	7	7
732	2235	9606218_223	There is a remarkable association of skin laxity and fragility with the targeted lumican null mutation seen in this study, |A1:**1SP3E3| |A2:**1SP2E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3| and in the targeted decorin and more recently developed thrombospondin 2 null mutations ( 12, 23). |A1:**2SP3E23| |A2:**2SP2E2| |A3:**2SP3E2| |A4:**2SP3E2| |A5:**2SP3E2|
				Annotation	1SP3E3 2SP3E23	1SP2E3 2SP2E2	1SP3E3 2SP3E2	1SP3E3 2SP3E2	1SP3E3 2SP3E2
				Evidence	4 3	4 3	4 3	4 3	4 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	6 6	7 7	7 7	7 7
733	1278	7775475_7	The APP was also detected by mAb 6E10 which recognizes an epitope of A4 (data not shown). |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E1	1SP3E1	1SP3E3	1SP3E3	1SP3E3
				Evidence	2	2	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
734	3166	12455503_193	Weaker staining is also apparent at 87A/C (Figure 6A). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1MP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	2	1
				Polarity	7	7	7	7	7
735	2443	10594025_103	As shown in Fig. 2B, three ClaI- ClaI fragments of 1.3, 2.5, and 4.9 kb were deleted to remove YCK3, YER124, RSP5, and YER126 (plasmid 1). |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1MP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	2	4	4	2
				Polarity	7	7	7	7	7
736	3080	9857186_99	We were unable to detect any PP2A activity or protein associated with endogenous PKBalpha in immunoprecipitates from unstimulated, stimulated or sorbitol-pre-treated HEK-293 cell extracts (data not shown). |A1:**1MP3E1| |A2:**1SN3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SN3E3|
				Annotation	1MP3E1	1SN3E1	1SP3E3	1SP3E3	1SN3E3
				Evidence	2	2	4	4	4
				Focus	2	4	4	4	4
				Polarity	7	1	7	7	1
737	4751	10801854_67	B, HA-tagged GCIP binds to full-length GST-Grap2 full-length protein and GST-Grap2-QC fusion protein, |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E3| but not the SH2 domain. |A3:**2SN3E0| |A1:**1SP3E0| |A2:**1SP3E0| |A4:**2SN3E0| |A5:**2SN3E3|
				Annotation	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 2SN3E0	1SP3E0 2SN3E0	1SP3E3 2SN3E3
				Evidence	1 1	1 1	1 1	1 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 1	7 1	7 1
738	1499	9465001_333	Correspondence should be addressed to Dr. John Oberdick, Department of Cell Biology, Neurobiology, and Anatomy/euroscience Division, The Ohio State University, 190 Rightmire Hall, 1060 Carmack Road, Columbus, OH 43210. |A1:**1GP1E0| |A2:**1GP3E0| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E0|
				Annotation	1GP1E0	1GP3E0	1GP3E3	1GP3E3	1GP3E0
				Evidence	1	1	4	4	1
				Focus	1	1	1	1	1
				Polarity	5	7	7	7	7
739	1154	10816499_79	A control group of six mice injected with BHI showed no effects. |A1:**1SN3E3| |A2:**1SN3E3| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1GN3E3|
				Annotation	1SN3E3	1SN3E3	1SN3E0	1SN3E0	1GN3E3
				Evidence	4	4	1	1	4
				Focus	4	4	4	4	1
				Polarity	1	1	1	1	1
740	7218	9083051_61	We reasoned that if [1-14C]farnesol of known specific activity was fed to rats in quantity, the urinary dicarboxylic acids produced should have the same specific activity as the farnesol that is dosed. |A1:**1SP2E3| |A2:**1SP2E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1SP2E3|
				Annotation	1SP2E3	1SP2E3	1SP2E3	1SP2E3	1SP2E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	6	6	6	6	6
741	6703	12051669_4	Konno, K. Ue, M. Khoroshev, H., Martinez, B.D. Ray, M.F. Morales, Proc. |A1:**1GP3E0| |A2:**1GP0E0| |A3:**1GP3E0| |A4:**1GP3E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP0E0	1GP3E0	1GP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	1	1	1	1
				Polarity	7	4	7	7	7
742	6901	9501233_68	This results in the reconstitution of spoIVFA and substitution of wild-type spoIVFB for the spoIVFB-gfp gene fusion. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E1|
				Annotation	1SP3E0	1SP3E1	1SP3E3	1SP3E3	1SP3E1
				Evidence	1	2	4	4	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
743	2413	9573068_58	Aggregates of Candida cells larger than four cells were not counted. |A1:**1GN3E3| |A2:**1SP3E3| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1MN3E3|
				Annotation	1GN3E3	1SP3E3	1SN3E0	1SN3E0	1MN3E3
				Evidence	4	4	1	1	4
				Focus	1	4	4	4	2
				Polarity	1	7	1	1	1
744	2877	8858153_2	In transgenic mice, LCRs confer high level expression on linked genes independent of position in the mouse genome. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0+| |A4:**1SP3E0+| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0+	1SP3E0+	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
745	7617	10330406_293	This measurement took into account differences in the total length of the bone rudiment |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1| and |A1:**1GP3E1| suggest that TGF-beta inhibits hypertrophic differentiation in addition to inhibiting longitudinal growth. |A1:**2SN3E1| |A2:**1SP3E1-| |A3:**2SP2E0-| |A4:**2SP2E0-| |A5:**2SP2E0-|
				Annotation	1GP3E1 1GP3E1 2SN3E1	1SP3E1- 1SP3E1- 1SP3E1-	1SP3E0 2SP2E0- 2SP2E0-	1SP3E0 2SP2E0- 2SP2E0-	1SP3E1 2SP2E0- 2SP2E0-
				Evidence	2 2 2	2 2 2	1 1 1	1 1 1	2 1 1
				Focus	1 1 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 1	7 7 7	7 6 6	7 6 6	7 6 6
746	1411	11238228_42	The peripheral blood (PB) mononuclear cell pellets were then resuspended and combined into one tube, to which further PBS (15 ml) was added. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
747	1707	9660938_68	As shown in Figure 3A, treatment of Jurkat cells with either etoposide or teniposide induced activation of the FasL promoter. |A1:**1SP3E3| |A2:**1MP3E3+| |A3:**1SP3E3+| |A4:**1SP3E3+| |A5:**1MSP3E3+|
				Annotation	1SP3E3	1MP3E3+	1SP3E3+	1SP3E3+	1MSP3E3+
				Evidence	4	4	4	4	4
				Focus	4	2	4	4	6
				Polarity	7	7	7	7	7
748	5043	10347063_8	The presence of alasan moreR than doubled the rate of [14] fluoranthene mineralization and significantly increased the rate of [14] phenanthrene mineralization by Sphingomonas paucimobilis EPA505. |A1:**1SP3E3+| |A2:**1SP3E3+| |A3:**1SP3E0+| |A4:**1SP3E0+| |A5:**1SP3E3+|
				Annotation	1SP3E3+	1SP3E3+	1SP3E0+	1SP3E0+	1SP3E3+
				Evidence	4	4	1	1	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
749	8121	12201801_3	The purposes of this study were to identify the determinants of the STS movement and to describe their influence on the performance of the STS movement. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	4	4
				Polarity	7	7	7	7	7
750	7752	9584203_110	The beads were resuspended into 30 mul of Rb kinase buffer containing 2 mug of GST-Rb (Santa Cruz Biotechnology), 2.5 mM EGTA, 10 mM beta-glycerophosphate, 0.1 mM sodium orthovanadate, 1 mM NaF, 20 muM ATP, and 5 muCi of [gamma-32] ATP and then incubated at 30 degrees C for 30 min. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
751	3759	9252397_41	Data are for the same sequences as shown in Fig. 3. [View Larger Version of this Image (47K GIF file)] Repair in XPD Cells A fibroblast strain from an XPD patient was analyzed in Fig. 5. |A1:**1SP3E3| |A2:**1SP3E3| Similar to XPA, these cells showed a strong deficiency of repair at all sequences analyzed including the sequences near the transcription initiation site and the transcribed strand. |A1:**2SP3E3| |A2:**2SP3E1-| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3 2SP3E3	1SP3E3 2SP3E1-	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3
				Evidence	4 4	4 2	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
752	5231	12054873_4	Insertions include two, long alpha-helices located on opposite sides of the beta-clam and three flexible loops. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
753	3820	11997515_16	Thus, Axin is a negative regulator of the Wnt signaling pathway |A3:**1SP3E0| |A4:**1SP3E0| and inhibits axis formation. |A3:**2SP3E0-| |A1:**1SN3E0| |A2:**1SP3E0-| |A4:**2SP3E0-| |A5:**1SP3E1-|
				Annotation	1SN3E0 1SN3E0	1SP3E0- 1SP3E0-	1SP3E0 2SP3E0-	1SP3E0 2SP3E0-	1SP3E1- 1SP3E1-
				Evidence	1 1	1 1	1 1	1 1	2 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	7 7	7 7	7 7	7 7
754	1503	11158320_332	Although additional work is needed to establish whether dASF and hASF can recognize the same enhancer sequences naturally occurring in pre-mRNAs, |A1:**1SP2E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1SP1E0| it is striking that a similar set of SR proteins from HeLa and Kc extracts bind the Drosophila dsx splicing enhancer ( 31), |A1:**2SP3E2| |A2:**1SP2E2| |A3:**2SP3E2| |A4:**2SP3E2| |A5:**2SP3E2| a cis-acting regulatory sequence required for dsx pre-mRNA splicing regulation in the cascade of splicing events leading to female sexual differentiation. |A1:**3SP3E0| |A2:**2SP3E0| |A3:**3SP3E0| |A4:**3SP3E0| |A5:**3SP3E0|
				Annotation	1SP2E0 2SP3E2 3SP3E0	1SP2E2 1SP2E2 2SP3E0	1SP2E0 2SP3E2 3SP3E0	1SP2E0 2SP3E2 3SP3E0	1SP1E0 2SP3E2 3SP3E0
				Evidence	1 3 1	3 3 1	1 3 1	1 3 1	1 3 1
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	6 7 7	6 6 7	6 7 7	6 7 7	5 7 7
755	8687	10366588_124	TRN-SR binds to the RS domains of both ASF/SF2 and SC35 SC35, |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E3| but not to IBB or to hnRNP A1 M9 (Fig. 4 A). |A1:**2SN3E3| |A2:**2SN3E3| |A3:**2SN3E3| |A4:**2SN3E3| |A5:**2SN3E3|
				Annotation	1SP3E3 2SN3E3	1SP3E3 2SN3E3	1SP3E0 2SN3E3	1SP3E0 2SN3E3	1SP3E3 2SN3E3
				Evidence	4 4	4 4	1 4	1 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 1	7 1	7 1	7 1	7 1
756	9549	11035751_63	The sequence of the genomic DNA from each subject was determined using a Model 377 automated DNA sequencer (Perkin-Elmer). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
757	7858	10583974_17	Compared with methane biogeochemistry, |A3:**1SP3E0| |A4:**1SP3E0| relatively little is known about CO biogeochemistry (11). |A3:**2SP1E2| |A1:**1SP3E2| |A2:**1SP1E2| |A4:**2SP1E2| |A5:**1GP3E2|
				Annotation	1SP3E2 1SP3E2	1SP1E2 1SP1E2	1SP3E0 2SP1E2	1SP3E0 2SP1E2	1GP3E2 1GP3E2
				Evidence	3 3	3 3	1 3	1 3	3 3
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	5 5	7 5	7 5	7 7
758	5189	7730324_22	CHO/IR cells were grown to confluency on uncoated tissue culture plates and incubated in the absence (panel A) or in the presence of 0.03 (panel B), 0.1 (panel C), 1.0 (panel D), 3 (panel E), and 30 (panel F) nM insulin for 15 min at 37 degrees C. The cells were then fixed, detergent permeabilized, and TRITC-phalloidin labeled for actin stress fibers as described under ``Experimental Procedures. '' Procedures.'' |A1:**1MP3E3| To further characterize the tyrosine dephosphorylation of pp125, pp125, we examined the time-dependence of this effect following insulin treatment (Fig. 4). |A1:**2MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3 2MP3E3	1MP3E3 1MP3E3	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	2 2	4 4	4 4	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
759	6728	11006292_9	Center line represents genomic DNA containing restriction sites for EcoRI (E), HindIII ( H), BamHI (B), NotI (N), and EcoRV (V); large central arrow represents protein coding region. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E3	1SP3E3	1SP3E0
				Evidence	1	1	4	4	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
760	9814	9508295_88	Briefly, 15 mul of the PCR product was analyzed on a 2% agarose gel. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
761	3490	10669745_257	Under the same experimental conditions, |A3:**1MP3E3| |A4:**1MP3E3| the overexpression of Vav Y3xF led to a higher increase in the basal activity of NF-AT |A3:**2SP3E0+| |A4:**2SP3E0+| in nonstimulated cells than that observed upon wild-type Vav overexpression (Fig. 6A). |A3:**3SP3E3+| |A1:**1SP3E3+| |A2:**1SP3E3+| |A4:**3SP3E3+| |A5:**1SP3E3+|
				Annotation	1SP3E3+ 1SP3E3+ 1SP3E3+	1SP3E3+ 1SP3E3+ 1SP3E3+	1MP3E3 2SP3E0+ 3SP3E3+	1MP3E3 2SP3E0+ 3SP3E3+	1SP3E3+ 1SP3E3+ 1SP3E3+
				Evidence	4 4 4	4 4 4	4 1 4	4 1 4	4 4 4
				Focus	4 4 4	4 4 4	2 4 4	2 4 4	4 4 4
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
762	9003	10402473_65	To quantitate AP-VEGF165, supernatants were assayed for AP activity. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E0	1SP3E0	1MP3E3
				Evidence	4	4	1	1	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
763	2705	11684656_443	Axis induction by Wnt signaling: Target promoter responsiveness regulates competence. |A1:**1SP2E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP2E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	6	7	7	7	7
764	9390	12101001_1	The Vc-NhaD is an Na(+)/H(+) antiporter from Vibrio cholerae belonging to a new family of bacterial Na(+)/H(+) antiporters, the NhaD family. |A1:**1GP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1GP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
765	7444	11740943_249	We expected two main benefits with this approach: |A1:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| the identification of components of the PKB/Dakt1 signaling pathway |A1:**2SP2E3| and the implication of this protein kinase in additional biological functions. |A1:**3SP2E3| |A2:**1SP1E3| |A3:**2SP3E0| |A4:**2SP3E0| |A5:**1SP2E3|
				Annotation	1GP3E3 2SP2E3 3SP2E3	1SP1E3 1SP1E3 1SP1E3	1SP3E3 2SP3E0 2SP3E0	1SP3E3 2SP3E0 2SP3E0	1SP2E3 1SP2E3 1SP2E3
				Evidence	4 4 4	4 4 4	4 1 1	4 1 1	4 4 4
				Focus	1 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 6 6	5 5 5	7 7 7	7 7 7	6 6 6
766	2038	9736606_213	For both complexes, the crystal size was ~0.2x0.3x0.5 mm3. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1GP3E3
				Evidence	4	4	1	1	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
767	7893	9647816_359	It also may be present in very low concentrations. |A1:**1GP1E0| |A2:**1GP1E0| |A3:**1GP2E0| |A4:**1GP2E0| |A5:**1GP2E0|
				Annotation	1GP1E0	1GP1E0	1GP2E0	1GP2E0	1GP2E0
				Evidence	1	1	1	1	1
				Focus	1	1	1	1	1
				Polarity	5	5	6	6	6
768	6354	9501077_268	We speculate that the transformation from spheres to cylinders involves converting a trimeric capsid interface to a dimeric interface. |A1:**1SP1E3| |A2:**1SP1E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP2E0|
				Annotation	1SP1E3	1SP1E0	1SP3E3	1SP3E3	1SP2E0
				Evidence	4	1	4	4	1
				Focus	4	4	4	4	4
				Polarity	5	5	7	7	6
769	6113	9843574_70	Complementation tests were performed by constructing stable diploid cell lines (Ebersold, 1967). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1MP3E2|
				Annotation	1MP3E3	1MP3E3	1SP3E2	1SP3E2	1MP3E2
				Evidence	4	4	3	3	3
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
770	6867	12195399_3	In these cases the dialysis activity is considered within the final DRG (Diagnosis Related Group). |A1:**1GP3E3| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1GP3E3	1SP3E1	1SP3E0	1SP3E0	1GP3E3
				Evidence	4	2	1	1	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
771	9772	11854438_15	Recently, there is increasing evidence that the abnormalities in these inputs play a crucial role in the pathophysiology of such diverse basal ganglia disorders as Parkinson's disease (Calabresi et al., 1996) and Huntington's disease (DiFiglia, 1990). |A1:**1GP3E2| |A2:**1SP2E2| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1SP3E2+|
				Annotation	1GP3E2	1SP2E2	1SP2E0	1SP2E0	1SP3E2+
				Evidence	3	3	1	1	3
				Focus	1	4	4	4	4
				Polarity	7	6	6	6	7
772	1564	10542210_66	It is unclear whether these transcripts indicate a downstream transcriptional start region or else 5' truncation in vivo. |A1:**1SP0E0| |A2:**1SP0E0| |A3:**1SP0E0| |A4:**1SP0E0| |A5:**1SP0E1|
				Annotation	1SP0E0	1SP0E0	1SP0E0	1SP0E0	1SP0E1
				Evidence	1	1	1	1	2
				Focus	4	4	4	4	4
				Polarity	4	4	4	4	4
773	1051	12676582_389	The profile of cells in the G0/G1, S, and G2/M phases of the cell cycle were analyzed by the UCSF Cancer Center Cytometry Core, on a FACSCaliber with Cellquest (Becton Dickinson) or ModFit (Verity Software House) Software. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
774	1820	11114897_166	Time points (minutes) at which reactions were stopped are indicated. |A1:**1GP3E3| |A2:**1GP2E3| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP2E3	1GP3E3	1GP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	1	1	1
				Polarity	7	6	7	7	7
775	8366	9700171_227	All these results indicate that alphaE-catenin can directly bind to the head domain of vinculin at the 326-509 domain. |A1:**1SP3E0| |A2:**1SP2E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E0	1SP2E1	1SP3E3	1SP3E3	1SP3E3
				Evidence	1	2	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	6	7	7	7
776	8348	12540579_5	E. histolytica also ingested apoptotic Jurkat cells more rapidly than necrotic control cells (8.5% plus-or-minus 0.4% versus 3.5% plus-or-minus 0.7%, respectively [mean and SD]) (P ( P < 0.001). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
777	4831	11897071_4	A total of 905 isolates from the B. cepacia complex were recovered from 447 patients in 8 of the 10 provinces; 369 (83%) of these patients had genomovar III and 43 (9.6%) had B. multivorans (genomovar II). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1SP3E3
				Evidence	4	4	1	1	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
778	6200	11751871_4	Further analysis demonstrated that serum or 12- O-tetradecanoylphorbol-13-acetate activation |A3:**1SP3E3| |A4:**1SP3E3| of several immediate early genes including fos, fosB, junB, and egr1 was inhibited by Wnt signaling. |A3:**2SP3E3-| |A1:**1SN3E3| |A2:**1SP3E3-| |A4:**2SP3E3-| |A5:**1SP3E3-|
				Annotation	1SN3E3 1SN3E3	1SP3E3- 1SP3E3-	1SP3E3 2SP3E3-	1SP3E3 2SP3E3-	1SP3E3- 1SP3E3-
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	7 7	7 7	7 7	7 7
779	3154	9668065_25	Acute short term UVB (280-320 nm) absorption by keratinocytes results in oxidative stress and DNA damage (20). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
780	1730	9851974_249	The supernatant from DF-1 cells infected with and producing RCAS vectors was filtered through a 0.45-mum filter and plated directly onto primary brain cells cultures from Gtv-a mice. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
781	8425	10958667_214	In addition, our data are similar to a number of experimental findings |A3:**1SP3E3| |A4:**1SP3E3| with PARP inhibitors or with PARP antisense strategies (9). |A3:**2SP3E2| |A1:**1SP3E23| |A2:**1SP3E23| |A4:**2SP3E2| |A5:**1GP3E23|
				Annotation	1SP3E23 1SP3E23	1SP3E23 1SP3E23	1SP3E3 2SP3E2	1SP3E3 2SP3E2	1GP3E23 1GP3E23
				Evidence	3 3	3 3	4 3	4 3	3 3
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
782	9224	11861554_287	LIM, D. S. and P. HASTY, 1996 A mutation in mouse rad51 results in an early embryonic lethal |A1:**1SP3E3| that is suppressed by a mutation in p53. |A1:**2SN3E3| |A2:**1SP3E2-| |A3:**1SP3E2-| |A4:**1SP3E2-| |A5:**1SP3E2-|
				Annotation	1SP3E3 2SN3E3	1SP3E2- 1SP3E2-	1SP3E2- 1SP3E2-	1SP3E2- 1SP3E2-	1SP3E2- 1SP3E2-
				Evidence	4 4	3 3	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 1	7 7	7 7	7 7	7 7
783	8198	12029205_5	All prognostic parameters were obtained before beta blocker therapy was initiated. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1GP3E3	1SP3E3	1SP3E0	1SP3E0	1GP3E3
				Evidence	4	4	1	1	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
784	7392	11719191_368	Bafico A., Liu G., Yaniv A., Gazit A. and Aaronson S.A. (2001) Novel mechanism of Wnt signalling inhibition mediated by Dickkopf-1 interaction with LRP6/Arrow. |A1:**1SP3E3| |A2:**1SP2E2| |A3:**1SP3E2-| |A4:**1SP3E2-| |A5:**1SP3E2|
				Annotation	1SP3E3	1SP2E2	1SP3E2-	1SP3E2-	1SP3E2
				Evidence	4	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	6	7	7	7
785	5864	12172941_9	It is safer than a freestanding, noncontact, laser beam. |A1:**1GP3E0| |A2:**1GP3E0| |A3:**1GP2E0| |A4:**1GP2E0| |A5:**1GP3E0|
				Annotation	1GP3E0	1GP3E0	1GP2E0	1GP2E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	1	1	1	1
				Polarity	7	7	6	6	7
786	5440	9844016_12	Release and uptake of GABA at synaptic terminals are reduced (12-14), |A1:**1SP3E23| |A2:**1SP3E2-| |A3:**1SP3E2-| |A4:**1SP3E2-| |A5:**1SP3E2-| and agonist binding to GABA type A (GABAA) receptors is altered. |A1:**2SP3E3| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**2SP3E0| |A5:**2SP3E0|
				Annotation	1SP3E23 2SP3E3	1SP3E2- 1SP3E0	1SP3E2- 1SP3E0	1SP3E2- 2SP3E0	1SP3E2- 2SP3E0
				Evidence	3 4	3 1	3 1	3 1	3 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
787	3801	12086892_198	Thus, it is not surprising that transfection of the PlGF-2 gene in tumor cells does not significantly alter tumor growth (Hiratsuka et al., 2001 |A1:**1SN3E2| |A2:**1SN3E2| |A3:**1SN3E2| |A4:**1SN3E2| |A5:**1SN3E2|
				Annotation	1SN3E2	1SN3E2	1SN3E2	1SN3E2	1SN3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	1	1	1	1	1
788	1059	9628893_139	Lat-A treatment results in loss of linear, long-distance mitochondrial movement. |A1:**1SP3E0| |A2:**1SP3E0-| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0-	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
789	8625	10601344_384	While many components of intercellular adherens junctions and focal contacts are specific to one or the other structure, |A1:**1SP3E0| other proteins such as vinculin and alpha-actinin, are found in both complexes. |A1:**2SP3E3| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0 2SP3E3	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E0 1SP3E0
				Evidence	1 4	1 1	1 1	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
790	1193	10589682_242	Thrombin (Boehringer Mannheim) digestion at a ratio of 1:20 (thrombin:Pelle-DD, w/w) at 4 degrees C proceeded for 5 hr and was stopped with 2.5 mM ethelenediamine-tetraacetic acid (EDTA). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
791	5636	11371357_252	Indeed, local reactivation of infiltrating T cells seems to be correlated with pathogenic potential. |A1:**1SP2E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1SP2E0|
				Annotation	1SP2E0	1SP2E0	1SP2E0	1SP2E0	1SP2E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	6	6	6	6	6
792	4777	12085246_1	Conditionally replicating adenoviruses (CRADs) are a novel strategy in cancer treatment |A5:**1GP3E0| and clinical trials using CRADs targeted to tumor cells have been reported recently. |A5:**2GP3E1| |A1:**1GP3E1| |A2:**1SP3E1| |A3:**1SP3E1| |A4:**1SP3E1|
				Annotation	1GP3E1 1GP3E1	1SP3E1 1SP3E1	1SP3E1 1SP3E1	1SP3E1 1SP3E1	1GP3E0 2GP3E1
				Evidence	2 2	2 2	2 2	2 2	1 2
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
793	4610	11092897_37	However, it is important to know that this segment can play a negative role. |A1:**1GN1E0| |A2:**1GP0E0| |A3:**1GP3E0| |A4:**1GP3E0| |A5:**1GP3E0|
				Annotation	1GN1E0	1GP0E0	1GP3E0	1GP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	1	1	1	1
				Polarity	3	4	7	7	7
794	7995	9671454_306	For a DNA binding transcription factor this could occur if the DNA binding domain is left intact but the activation domain is deleted or mutated (18, 19). |A1:**1SP2E0| |A2:**1SP2E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP2E0	1SP2E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	1	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	6	6	7	7	7
795	7646	10330406_255	To determine if PTHrP is required for the effects of TGF-beta1 on metatarsal histology, |A5:**1SP3E0| hematoxylin and eosin-stained sections of organ cultures from PTHrP-positive (Fig. 8, A-C) and PTHrP-null embryos (Fig. 8, D-F) either untreated or treated with TGF-beta1 were examined. |A5:**2MP3E3| |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3|
				Annotation	1MP3E3 1MP3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1SP3E0 2MP3E3
				Evidence	4 4	4 4	4 4	4 4	1 4
				Focus	2 2	4 4	2 2	2 2	4 2
				Polarity	7 7	7 7	7 7	7 7	7 7
796	5297	12676582_359	SW480, HT-29, SW 48, DLD-1, HCT 116, U-2 OS, T98G, Saos-2, HeLa, and C33A were obtained from the American Type Culture Collection. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E3	1GP3E3	1SP3E0	1SP3E0	1GP3E0
				Evidence	4	4	1	1	1
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
797	771	9835589_47	Aliquots of culture (5 to 50 ml, depending on the biomass) were centrifuged at 14,000 x g for 8 min at 4 degrees C. Aliquots from the supernatant fluid were frozen for pyruvate analyses. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
798	8516	11463376_87	Amino acids were classified as follows: small residues, P, A, G, S, T; hydrophobic, L, I, V, A, F, M, C, Y, W; polar/acidic, D, E, Q, N; and basic, R, K, H. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1SP3E0
				Evidence	4	4	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
799	3447	12004072_134	When the DNA constructs were transfected into HeLa-E cells, proteins of the expected sizes were detected by Western blotting (data not shown). |A1:**1MP3E1| |A2:**1MP3E1| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E1	1MP3E1	1MP3E3	1MP3E3	1MP3E3
				Evidence	2	2	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
800	9457	8673702_137	In contrast with CpG methylation, the mitogenic activity of Drosophila DNA was not impaired by treatment with Taq-I methylase (Figure 5F); |A1:**1SN3E3| |A2:**1SN3E3| |A3:**1SN3E3| |A4:**1SN3E3| this enzyme methylates adenosine within the TCGA motif |A1:**2SP3E3| but does not induce CpG methylation. |A1:**3SN3E3| |A2:**2SN3E0| |A3:**2SN3E0| |A4:**2SN3E0| |A5:**1SN3E3|
				Annotation	1SN3E3 2SP3E3 3SN3E3	1SN3E3 2SN3E0 2SN3E0	1SN3E3 2SN3E0 2SN3E0	1SN3E3 2SN3E0 2SN3E0	1SN3E3 1SN3E3 1SN3E3
				Evidence	4 4 4	4 1 1	4 1 1	4 1 1	4 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	1 7 1	1 1 1	1 1 1	1 1 1	1 1 1
801	9268	9933629_273	Even under the harshest conditions, 5 mM hydrogen peroxide, the transcomplemented strain's viability differed by <1 log unit from that of the wild type (Fig. 6 C). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
802	645	11859073_12	Of the A. aeolicus proteins studied in this report, these two subunits display the least percent identity to the corresponding E. coli subunit sequences (see Fig. 1 B). |A1:**1SP3E3-| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3| Despite the rather wide sequence variations in A. aeolicusdelta and delta' compared with their E. coli counterparts, they are remarkably similar to the behavior of E. coli proteins in ability to form deltadelta' and taudeltadelta' complexes which remain associated during gel filtration analysis ( ). |A1:**2MP3E23| |A2:**2SP2E2| |A3:**2MP3E3| |A4:**2MP3E3| |A5:**2SP3E2|
				Annotation	1SP3E3- 2MP3E23	1SP3E3 2SP2E2	1SP3E3 2MP3E3	1SP3E3 2MP3E3	1GP3E3 2SP3E2
				Evidence	4 3	4 3	4 4	4 4	4 3
				Focus	4 2	4 4	4 2	4 2	1 4
				Polarity	7 7	7 6	7 7	7 7	7 7
803	3773	12037418_3	Since then, speech and language rehabilitation programs have been expanding both in size and quality, |A5:**1GP3E0+| resulting in about 1,000 speech therapists practicing in hospitals and rehabilitation centers throughout the country. |A5:**2GP3E0| |A1:**1GP3E1| |A2:**1GP3E1| |A3:**1SP3E0| |A4:**1SP3E0|
				Annotation	1GP3E1 1GP3E1	1GP3E1 1GP3E1	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1GP3E0+ 2GP3E0
				Evidence	2 2	2 2	1 1	1 1	1 1
				Focus	1 1	1 1	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
804	5976	11982984_5	RESULTS: In 16 patients the pelvic mass was found to be benign while in 11 patients a malignant recurrence was diagnosed. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
805	7040	11333274_39	The conditions for detecting the molecular ion were developed using the authentic standards S-(benzohydroximoyl)-L-cysteine and S-(benzohydroximoyl)- N-acetyl-L-cysteine. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| When [U-14C] p-hydroxyphenylacetaldoxime and NADPH were added to microsomes from S. alba in the absence of a sulfur donor, a radiolabeled compound (X) accumulated in the reaction mixtures as evidenced by TLC (Fig. 1, columns 1 and 6). |A1:**2MP3E3| |A2:**2MP3E3| |A3:**2MP3E3| |A4:**2MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3 2MP3E3	1SP3E3 2MP3E3	1SP3E0 2MP3E3	1SP3E0 2MP3E3	1MP3E3 1MP3E3
				Evidence	4 4	4 4	1 4	1 4	4 4
				Focus	4 2	4 2	4 2	4 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
806	8293	11896887_8	RESULTS: Our results showed that this combination therapy is more effective than the previous regimen. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3+|
				Annotation	1GP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3+
				Evidence	4	4	4	4	4
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
807	1575	9811641_21	We demonstrate that the expression of the dctA gene, the structural gene encoding the transporter for C4-dicarboxylates, enables an atp deletion strain to grow on the C4-dicarboxylates. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
808	3258	10583997_438	This was demonstrated when total DNA was hybridized by using a universal probe (Table 3) and also when a specific indigenous organism (S. fragile) was traced (Fig. 5). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
809	825	10075703_132	The addition of the proteasome inhibitor ALLN, |A5:**1GP3E3| which inhibits p53 degradation (19) |A5:**2GP3E2-| |A1:**1SN3E2| |A2:**1SP3E2-| |A3:**1SP3E3-| |A4:**1SP3E3-| caused an accelerated accumulation of p53 protein in hypoxic HUVEC (Fig. 5). |A5:**3GP3E3+| |A1:**2SP3E3+| |A2:**2SP3E3+| |A3:**2SP3E3| |A4:**2SP3E3|
				Annotation	1SN3E2 1SN3E2 2SP3E3+	1SP3E2- 1SP3E2- 2SP3E3+	1SP3E3- 1SP3E3- 2SP3E3	1SP3E3- 1SP3E3- 2SP3E3	1GP3E3 2GP3E2- 3GP3E3+
				Evidence	3 3 4	3 3 4	4 4 4	4 4 4	4 3 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	1 1 7	7 7 7	7 7 7	7 7 7	7 7 7
810	3174	11809809_23	During embryonal development, Wnt signaling stabilizes beta-catenin by blocking the activity of the conductin/axin-based beta-catenin degradation complex. |A1:**1SP3E0| |A2:**1SP3E0-| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0-|
				Annotation	1SP3E0	1SP3E0-	1SP3E0	1SP3E0	1SP3E0-
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
811	538	10594025_47	One of the alleles described here, rsp5-25, contains two changes in its open reading frame (ORF). |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E1	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	2	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
812	3719	10399933_109	The deeper layers of the cortical plate (representing neurons that had finished their migration days previously) showed lower levels of expression of DCX, |A1:**1SP3E3-| |A2:**1SP3E3-| |A5:**1GP3E3-| whereas neurons in the intermediate zone that were presumably still migrating also showed high levels of expression. |A1:**2SP3E3+| |A2:**2SP2E3+| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**2GP3E3+|
				Annotation	1SP3E3- 2SP3E3+	1SP3E3- 2SP2E3+	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1GP3E3- 2GP3E3+
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 6	7 7	7 7	7 7
813	5513	12137688_10	Quantitative data are presented using relative risks or mean differences together with 95 per cent confidence limits. |A1:**1GP3E3| |A2:**1GP3E1| |A3:**1GP3E0| |A4:**1GP3E0| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E1	1GP3E0	1GP3E0	1GP3E3
				Evidence	4	2	1	1	4
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
814	775	12069872_4	RESULTS: CFS sufferers did not demonstrate any impairment in objective cognitive functioning compared to the control group, |A1:**1GN3E3| and objective performance was not related to their higher levels of depression or their level of fatigue. |A1:**2GN3E3-| |A2:**1SN3E3| |A3:**1SN3E3| |A4:**1SN3E3| |A5:**1GN3E3|
				Annotation	1GN3E3 2GN3E3-	1SN3E3 1SN3E3	1SN3E3 1SN3E3	1SN3E3 1SN3E3	1GN3E3 1GN3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	1 1	1 1	1 1	1 1	1 1
815	6658	11110663_9	Furthermore, we demonstrate the synergistic interactions of the extracellular polypeptide ligands FGF 19 FGF-19 and Wnt 8c Wnt-8c as mediators of mesodermal and neural signals, respectively, initiating inner ear development. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
816	2756	9707632_79	The I- V curve for the outward current showed a null potential at about 18 mV, |A1:**1SN3E3| |A2:**1SN3E3| and the outward current elicited by 10 mM Zn2+ Zn2 was similar to that elicited by 1 mM Zn2+ Zn2 |A1:**2SP3E3+| |A2:**2SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3| whereas 0.5 mM Zn2+ Zn2 did not elicit an appreciable outward current. |A1:**3SN3E3| |A2:**3SN3E3| |A3:**2SN3E0| |A4:**2SN3E0| |A5:**2GN3E3|
				Annotation	1SN3E3 2SP3E3+ 3SN3E3	1SN3E3 2SP3E3 3SN3E3	1SP3E3 1SP3E3 2SN3E0	1SP3E3 1SP3E3 2SN3E0	1GP3E3 1GP3E3 2GN3E3
				Evidence	4 4 4	4 4 4	4 4 1	4 4 1	4 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	1 7 1	1 7 1	7 7 1	7 7 1	7 7 1
817	4785	11381111_24	Studies of COMT knockout mice, similarly, have demonstrated that dopamine levels are increased only in prefrontal cortex (33) |A2:**1SP3E2+| |A3:**1SP3E2+| |A4:**1SP3E2+| and, remarkably, that memory performance is enhanced. |A2:**2SP3E0+| |A1:**1SP3E2| |A3:**2SP3E0+| |A4:**2SP3E0+| |A5:**1GP3E2+|
				Annotation	1SP3E2 1SP3E2	1SP3E2+ 2SP3E0+	1SP3E2+ 2SP3E0+	1SP3E2+ 2SP3E0+	1GP3E2+ 1GP3E2+
				Evidence	3 3	3 1	3 1	3 1	3 3
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
818	8035	11997333_27	The ambiguity in what is finished |A4:**1SP1E0| and what is not stems from the disassociation of these two major sequencing steps in large-scale sequencing projects. |A4:**2SN3E0| |A1:**1SP0E0| |A2:**1SP1E0| |A3:**1SN1E1| |A5:**1GN3E0|
				Annotation	1SP0E0 1SP0E0	1SP1E0 1SP1E0	1SN1E1 1SN1E1	1SP1E0 2SN3E0	1GN3E0 1GN3E0
				Evidence	1 1	1 1	2 2	1 1	1 1
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	4 4	5 5	3 3	5 1	1 1
819	7511	9529373_95	Bound antibodies were visualized by an ECL detection method (Amersham, Buckinghamshire, UK). |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1SP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	4	2	2	2
				Polarity	7	7	7	7	7
820	5801	12081574_12	By contrast, NHE-3 mRNA levels were not different between SHR |A4:**1SN3E0| and WKY rats at each age group. |A4:**2SP3E0| |A1:**1SN3E3| |A2:**1SN3E3| |A3:**1SN3E3| |A5:**1GN3E3|
				Annotation	1SN3E3 1SN3E3	1SN3E3 1SN3E3	1SN3E3 1SN3E3	1SN3E0 2SP3E0	1GN3E3 1GN3E3
				Evidence	4 4	4 4	4 4	1 1	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	1 1	1 1	1 1	1 7	1 1
821	7569	12399452_34	Systolic blood pressure of male GFAP58.8 (solid bars) and non-transgenic or control (open bars) mice at 10-12 weeks of age (BP) was recorded by the tail cuff method. |A3:**1MP3E3| |A1:**1MP3E3| |A2:**1MP3E3| |A4:**1MP3E3| |A5:**1GMP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1GMP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	3
				Polarity	7	7	7	7	7
822	1631	10948110_58	The concentration of HDL was expressed as the equivalent concentration of cholesterol in micrograms per milliliter as determined by a cholesterol assay (Sigma). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1GMP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1GMP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	3
				Polarity	7	7	7	7	7
823	7234	11466286_84	The program tRNAscan was used to identify tRNA genes. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1SP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	4	2	2	2
				Polarity	7	7	7	7	7
824	5412	10427095_359	Laurent, M.N., Blitz, I.L., Hashimoto, C., Rothbacher, U., Cho, K.W. (1997) |A3:**1GP3E2| |A4:**1GP3E2| The Xenopus homeobox gene twin mediates Wnt induction of goosecoid in establishment of Spemann's organizer. |A3:**2SP3E0+| |A1:**1SP3E3| |A2:**1SP3E3| |A4:**2SP3E0+| |A5:**1SP3E2|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1GP3E2 2SP3E0+	1GP3E2 2SP3E0+	1SP3E2 1SP3E2
				Evidence	4 4	4 4	3 1	3 1	3 3
				Focus	4 4	4 4	1 4	1 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
825	1797	9822727_124	A final cut of 200 mum containing only the outer retina (OR) composed of the onl and PR outer segments (os) was then made. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E0	1MP3E3
				Evidence	4	4	4	1	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
826	3178	11325943_12	FliM receives the output of the chemotactic system through its binding to the phosphorylated form of the response regulator CheY (CheY-P) (7, 25, 37, 38, 41). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
827	359	9462510_126	The center panels show representative Wright-stained cells after 4 days in culture; |A1:**1SP3E3| the same two clones, LXSN-10 and FLN 2.4, are depicted in each set of panels. |A1:**2SN3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3 2SN3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3	1SP3E3 1SP3E3	1GP3E3 1GP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	2 2	4 4	1 1
				Polarity	7 1	7 7	7 7	7 7	7 7
828	8020	10847682_23	Capping and severing proteins also limit the length of filaments (Ayscough, 1998). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
829	6019	12398896_154	We then used RNA interference to deplete -catenin in HCT116 cells and examined its effect on NF- B activities. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	4	4
				Polarity	7	7	7	7	7
830	9665	10816515_55	The plates were washed and blocked with 5% bovine serum albumin (BSA; Sigma) in PBS for 2 h at room temperature, emptied, and left to dry overnight. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
831	2112	11676922_202	Ca2+calmodulinndependent protein kinase II is stimulated by Wnt and Frizzled homologs and promotes ventral cell fates in Xenopus. |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP3E0+| |A4:**1SP3E0+| |A5:**1SP3E0+|
				Annotation	1SP3E3	1SP3E0	1SP3E0+	1SP3E0+	1SP3E0+
				Evidence	4	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
832	4912	10798393_57	Previous studies have shown that RNA in situ hybridizations could detect odorant receptor mRNA in olfactory neuron axon termini (Ressler et al. 1994 ; Vassar et al. 1994 ). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1MP3E2| |A4:**1MP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1MP3E2	1MP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	2	2	1
				Polarity	7	7	7	7	7
833	3872	11882285_400	However, plasmid carrying the noncleavable Rad21 gene was lethal even in the glucose-repressed condition, |A5:**1SP3E1| perhaps due to the toxicity by leaked synthesis of Rad21RERE. |A5:**2SP2E0| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A4:**1SP2E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP2E3 1SP2E3	1SP2E3 1SP2E3	1SP3E1 2SP2E0
				Evidence	4 4	4 4	4 4	4 4	2 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	6 6	6 6	7 6
834	6825	9673225_29	An equal volume of sample buffer (63 mM Tris-HCl [pH 6.8], 10% glycerol, 2% SDS) was added, and the protein solution was boiled for 5 min before further separation on a Prep-Cell column (Bio-Rad) in a matrix of 16% polyacrylamide at 200 V overnight. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
835	2254	11502887_22	Such assays were carried out by taking advantage of the fact that ddC is a specific substrate of Pol beta but is poorly incorporated by the replicative polymerases Pol delta, Pol alpha, and Pol epsilon. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1MP3E3	1SP3E3	1SP3E0	1SP3E0	1SP3E1
				Evidence	4	4	1	1	2
				Focus	2	4	4	4	4
				Polarity	7	7	7	7	7
836	4971	9529101_33	Specific-pathogen-free inbred C57BL/6, IL-4 KO, and GKO mice of both sexes, 6 to 8 weeks old, were challenged intraperitoneally (i.p.) with 108 C. albicans blastoconidia in two separate experiments. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
837	6692	10601210_210	However, the A. nidulans pacC mutant is unable to grow at alkaline pH (8). |A1:**1SN3E2| |A2:**1SN3E2| |A3:**1SN3E2| |A4:**1SN3E2| |A5:**1GN3E2|
				Annotation	1SN3E2	1SN3E2	1SN3E2	1SN3E2	1GN3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	1	1	1	1	1
838	5691	11014821_345	These isoforms are not interconvertible by treatment with urea or phosphatase, |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1GN3E1| suggesting that they possess different primary structures. |A3:**2SP2E0| |A1:**1SN3E3| |A2:**1SN3E1| |A4:**2SP2E0| |A5:**2SP2E1|
				Annotation	1SN3E3 1SN3E3	1SN3E1 1SN3E1	1SN3E0 2SP2E0	1SN3E0 2SP2E0	1GN3E1 2SP2E1
				Evidence	4 4	2 2	1 1	1 1	2 2
				Focus	4 4	4 4	4 4	4 4	1 4
				Polarity	1 1	1 1	1 6	1 6	1 6
839	3686	9052796_319	Samples were postfixed in 1% OsO4 in 0.1 Na cacodylate and dehydrated in a series of ascending ethanol gradients (70%, 85%, 95%, and 100%). |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
840	7337	10523671_7	The destabilization was markedly higher for complexes consisting of G4AD (aa 768 to 881) than for full-length Gal4p |A5:**1SP3E3+| |A3:**1SP3E0+| |A4:**1SP3E0+| suggesting that Gal80p relocated to a second site on full-length Gal4p. |A5:**2SP2E0| |A1:**1SP3E3+| |A2:**1SP3E3| |A3:**2SP2E0| |A4:**2SP2E0|
				Annotation	1SP3E3+ 1SP3E3+	1SP3E3 1SP3E3	1SP3E0+ 2SP2E0	1SP3E0+ 2SP2E0	1SP3E3+ 2SP2E0
				Evidence	4 4	4 4	1 1	1 1	4 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 6	7 6	7 6
841	7246	12192086_6	Second, we date the insertion event of the inactivating human-specific sahAluY element that replaced the ancestral AluSq element found adjacent to exon 6 of the CMAH gene in the chimpanzee genome. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E1	1SP3E0	1SP3E0	1GP3E3
				Evidence	4	2	1	1	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
842	6380	9845372_287	It was found that chromatin structure around the recombination hot spots changes in meiosis prior to DSB formation (Ohta et al., 1998). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E2| |A4:**1SP2E2| |A5:**1GP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E2	1SP2E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	6	7
843	8718	12818156_139	In (B) and (C), in the presence of nocodazole, NF- B p65 subunit translocation (nucleus strongly red) occurred in 100% of LPS 5a (blue) dIgAC5 (green) double positive cells. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GMP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GMP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	3
				Polarity	7	7	7	7	7
844	9053	10588655_14	Our data suggest that basal and radiation-stimulated p21 may play different roles in regulating cell cycle progression that affect cell survival after radiation exposure. |A1:**1SP1E3| |A2:**1SP1E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP2E3|
				Annotation	1SP1E3	1SP1E3	1SP2E3	1SP2E3	1GP2E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	5	5	6	6	6
845	9024	10864929_116	Indeed, the intensity of the bands corresponding to incorporation of AZTTP in front of the first two As in the template did not decrease over time, |A3:**1SN3E0-| |A4:**1SN3E0-| even in the presence of PPi (Fig. 5 B, right panel). |A3:**2SP3E3| |A1:**1SN3E3| |A2:**1SN3E3| |A4:**2SP3E3| |A5:**1SN3E3|
				Annotation	1SN3E3 1SN3E3	1SN3E3 1SN3E3	1SN3E0- 2SP3E3	1SN3E0- 2SP3E3	1SN3E3 1SN3E3
				Evidence	4 4	4 4	1 4	1 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 1	1 1	1 7	1 7	1 1
846	3361	12015965_58	The longest predicted open reading frame encodes a 519-amino acid protein. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP2E0	1SP2E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	7
847	6998	8662879_72	A level of expression of 1 refers to the expression of the CD-MPR or the CI-MPR in immortalized wild type fibroblasts, which were taken as positive control ( ). |A1:**1SP3E23| |A2:**1SP3E23| |A5:**1GP3E2| 100% of missorting was attributed to the MPR-negative fibroblasts that secrete 75% of the newly synthesized cathepsin D. |A1:**2SP3E3| All values are means plus-or-minus S.E. of three independent determinations. |A1:**3SP3E3| |A2:**2SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**2GP3E3|
				Annotation	1SP3E23 2SP3E3 3SP3E3	1SP3E23 2SP3E3 2SP3E3	1SP3E3 1SP3E3 1SP3E3	1SP3E3 1SP3E3 1SP3E3	1GP3E2 2GP3E3 2GP3E3
				Evidence	3 4 4	3 4 4	4 4 4	4 4 4	3 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	7 7 7	7 7 7	7 7 7	7 7 7	7 7 7
848	4379	9844016_33	Free-floating sections were treated as described ( 40) |A3:**1SP3E2| |A2:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2| and hybridized with 1 x 106 cpm/mul of [alpha-33]UTP-labeled antisense (or sense) riboprobes transcribed from a linearized gamma2 cDNA template (see below). |A3:**2MP3E3| |A1:**1SP3E3| |A2:**2MP3E3| |A4:**2MP3E3| |A5:**2MP3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E2 2MP3E3	1SP3E2 2MP3E3	1SP3E2 2MP3E3	1GP3E2 2MP3E3
				Evidence	4 4	3 4	3 4	3 4	3 4
				Focus	4 4	4 2	4 2	4 2	1 2
				Polarity	7 7	7 7	7 7	7 7	7 7
849	4592	11179290_61	At indicated time points cells, were collected, washed with annexin V staining buffer (HEPES buffer containing 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, and 1.8 mM CaCl2 [pH 7.4]), and labeled with phycoerythrin (PE)-conjugated annexin V (Pharmingen) for 15 min on ice to detect phosphatidylserine expression on the outer cell membrane layer. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
850	5782	10534472_14	This treatment strategy could be valuable for the prevention and management of restenosis. |A1:**1SP2E0| |A2:**1SP1E1| |A3:**1GP2E0| |A4:**1GP2E0| |A5:**1GP2E1|
				Annotation	1SP2E0	1SP1E1	1GP2E0	1GP2E0	1GP2E1
				Evidence	1	2	1	1	2
				Focus	4	4	1	1	1
				Polarity	6	5	6	6	6
851	2407	10523671_301	GT-Sepharose-bound proteins were analyzed by Western immunoblotting with rabbit polyclonal anti-Gal80p and anti-GST. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
852	9728	11156972_180	A CHTMAN et al. 1999 describe yet greater genetic homogeneity from global assays of the plague-causing Yersinia pestis, finding zero synonymous polymorphisms in sequences from several gene regions. |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E1| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E1	1SP3E2	1GP3E2
				Evidence	3	3	2	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
853	5083	12750340_193	The persistence of historical differences in MHC diversity among Peromyscus subgenera over millions of generations is consistent with this latter expectation, |A3:**1SP3E3| |A4:**1SP3E3| suggesting that demographic constrictions are rare event(s) in the history of Peromyscus taxa. |A3:**2SP2E0| |A1:**1SP3E0| |A2:**1GP3E0| |A4:**2SP2E0| |A5:**1GP3E0|
				Annotation	1SP3E0 1SP3E0	1GP3E0 1GP3E0	1SP3E3 2SP2E0	1SP3E3 2SP2E0	1GP3E0 1GP3E0
				Evidence	1 1	1 1	4 1	4 1	1 1
				Focus	4 4	1 1	4 4	4 4	1 1
				Polarity	7 7	7 7	7 6	7 6	7 7
854	9507	9659912_101	The numbering system for the various products is the same as that in Figure 1B. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E3	1GP3E3	1GP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
855	2209	10556096_44	In conclusion, the intranuclear distribution of genes, within sub-regions of the embryo where they are expressed, simply follows the expected average position of their chromosomal sites over the entire embryo. |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E1|
				Annotation	1SP3E1	1SP3E1	1SP3E0	1SP3E0	1GP3E1
				Evidence	2	2	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
856	4069	12137688_15	In contrast, haematoma block was quicker and easier to perform and less resource intensive. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E1	1SP3E3	1SP3E0	1GP3E3
				Evidence	4	2	4	1	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
857	9074	11427415_30	The elution profile showed two EPS fractions with molecular masses of 500 kDa and >2,000 kDa, respectively. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
858	9791	12147928_7	On average, patient-recorded blood pressures were equivalent to stored monitor values 80% or more of the time. |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP3E1|
				Annotation	1GP3E3	1SP3E3	1SP2E3	1SP2E3	1GP3E1
				Evidence	4	4	4	4	2
				Focus	1	4	4	4	1
				Polarity	7	7	6	6	7
859	1520	9528791_70	After digestion with NdeI, the SNT309-containing fragment was subcloned into pAR2156 (a gift from C. Wang) and pET15b for expression of Snt309p and His-tagged Snt309p by using T7 RNA polymerase. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
860	8477	11751871_165	This hypothesis is supported by the observation that Wnt treatment does not repress fos activation in all cell types, |A3:**1SN3E3| |A4:**1SN3E3| including some cell lines that are known to respond to Wnt by activating beta-catenin/LEF-mediated transcription. |A3:**2SP3E0| |A1:**1SP3E3| |A2:**1SN3E3| |A4:**2SP3E0| |A5:**1SN3E1|
				Annotation	1SP3E3 1SP3E3	1SN3E3 1SN3E3	1SN3E3 2SP3E0	1SN3E3 2SP3E0	1SN3E1 1SN3E1
				Evidence	4 4	4 4	4 1	4 1	2 2
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	1 1	1 7	1 7	1 1
861	3394	7545681_59	Only a trace level of the 50-60 kDa protein was present in the lysate, |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3| suggesting that it was secreted soon after synthesis. |A3:**2SP2E0| |A1:**1SP3E3| |A2:**1SP3E3| |A4:**2SP2E0| |A5:**2GP2E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 2SP2E0	1SP3E3 2SP2E0	1GP3E3 2GP2E3
				Evidence	4 4	4 4	4 1	4 1	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 6	7 6	7 6
862	9331	12238280_21	The hypothesis of splanchnic tissue hypoxia was examined from different approaches. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP2E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E1	1SP2E3	1SP3E3	1GP3E3
				Evidence	4	2	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	6	7	7
863	6952	10508171_197	However, T3-dependent repression was markedly reduced in the presence of TSA. |A1:**1SP3E3-| |A2:**1SP3E3-| |A3:**1SP3E0-| |A4:**1SP3E0-| |A5:**1GP3E1-|
				Annotation	1SP3E3-	1SP3E3-	1SP3E0-	1SP3E0-	1GP3E1-
				Evidence	4	4	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
864	7210	8703040_31	Du Clos and co-workers have compared CRP-binding sequences from histones H2A, H1, and the Sm-D protein from small nuclear ribonucleoprotein particles and have noted a motif consisting of the positively charged amino acids lysine or arginine, alternating with small neutral residues, usually alanine or glycine (). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP2E3| |A4:**1SP3E3| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP2E3	1SP3E3	1GP3E2
				Evidence	3	3	4	4	3
				Focus	4	4	4	4	1
				Polarity	7	7	6	7	7
865	5124	12676581_23	However, direct proof for the existence of this switch in spontaneously arising human tumors and an elucidation of its mechanism have remained elusive. |A1:**1SP3E1| |A2:**1SN0E0| |A3:**1SP0E0| |A4:**1SP0E0| |A5:**1GP3E0|
				Annotation	1SP3E1	1SN0E0	1SP0E0	1SP0E0	1GP3E0
				Evidence	2	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	4	4	4	7
866	2645	10653712_194	The formation of 2-carboxycinnamic acid may be well explained by an ortho-type cleavage (intradiol) of 1,2-dihydroxynaphthalene or a meta-type cleavage (extradiol) of 2,3-dihydroxynaphthalene (Fig. 5). |A1:**1SP1E3| |A2:**1SP1E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1SP3E3|
				Annotation	1SP1E3	1SP1E3	1SP2E3	1SP2E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	5	5	6	6	7
867	6696	11279203_24	A, amino acid composition of the V2R, NTR 1, NTR-1, OTR, and AT1AR carboxyl terminal carboxyl-terminal tails beginning with the conserved NP XXY motif, which marks the end of the seventh transmembrane domain. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E1|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E1
				Evidence	1	1	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
868	5313	9790533_93	Mutations of other highly conserved amino acids in the vicinity of this region also significantly affected nucleotide exchange. |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP2E3| |A4:**1SP2E0| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E0	1SP2E3	1SP2E0	1GP3E1
				Evidence	4	1	4	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	7
869	2882	12153528_2	Here, we report that the pathogenetic role of the endogenously accumulating metabolite d-2-hydroxyglutarate (D-2), which is structurally similar to the excitatory amino acid glutamate, |A3:**1SP3E3| |A4:**1SP3E3| is mediated by at least three mechanisms. |A3:**2SP2E0| |A1:**1SP3E3| |A2:**1SP3E3| |A4:**2SP2E0| |A5:**1SP3E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 2SP2E0	1SP3E3 2SP2E0	1SP3E3 1SP3E3
				Evidence	4 4	4 4	4 1	4 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 6	7 6	7 7
870	6490	10436059_48	The 153 residue C terminus is shared among netrins |A3:**1SP3E0| |A4:**1SP3E0| and is related to the C terminus of Frzb, an antagonist of the Wnt receptor (Leyns et al., 1997; Wang et al., 1997 ). |A3:**2SP3E2| |A1:**1SP3E2| |A2:**1SP3E2| |A4:**2SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E0 2SP3E2	1SP3E0 2SP3E2	1SP3E2 1SP3E2
				Evidence	3 3	3 3	1 3	1 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
871	2046	12496348_11	The present paper describes examinations of another DRIP, neuronal calcium sensor 1 (NCS-1), in the same tissue samples. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E1	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	2	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
872	7516	9573047_170	The onset of the disease was scored at the first appearance of symptoms (usually tremors or leg posturing) in days days. |A1:**1GP3E3| |A2:**1SP1E1| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E3|
				Annotation	1GP3E3	1SP1E1	1SP3E0	1SP3E0	1GP3E3
				Evidence	4	2	1	1	4
				Focus	1	4	4	4	1
				Polarity	7	5	7	7	7
873	9066	10882105_101	Expression is unaffected in clone 53 ES with a transgene insertion on chromosome 12. |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SN3E0| |A4:**1MN3E0| |A5:**1GN3E3|
				Annotation	1SP3E3	1SP3E0	1SN3E0	1MN3E0	1GN3E3
				Evidence	4	1	1	1	4
				Focus	4	4	4	2	1
				Polarity	7	7	1	1	1
874	2230	11086983_308	Furthermore, age, sex, substance abuse, and other factors also influence the course of the disease ( Frederikse et al. 2000 ; Gearon and Bellack 2000 ; Seeman 2000). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP2E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1SP2E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	6	7	7
875	7583	12370826_3	We have examined whether the localization of PAPIN is determined by p0071 in epithelial cells. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
876	4626	9566905_231	The Km and Vmax values for the phosphorylation of Axil(265-483) by GSK-3beta were calculated to be 6.4 nM and 580 pmol/min/mg, respectively (Fig. 7B). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
877	1780	10417191_135	Equivalent amounts of total protein of each fraction were then electrophoretically separated, transferred to nitrocellulose, and probed for hsp60 by Western blotting. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
878	8206	11448771_275	(c) sFRP/Frzb proteins, Cerberus, WIF-1 and other Wnt binding antagonists bind specific Wnt molecules |A1:**1SP3E0| and |A5:**1SP3E1| prevent Wnt interaction with Fz and/or LRP5/6; they thereby prevent formation of the Fz-LRP5/6 complex. |A1:**2SN3E0| |A2:**1SP3E1-| |A3:**1SP3E0-| |A4:**1SP3E0-| |A5:**2SP3E1-|
				Annotation	1SP3E0 2SN3E0 2SN3E0	1SP3E1- 1SP3E1- 1SP3E1-	1SP3E0- 1SP3E0- 1SP3E0-	1SP3E0- 1SP3E0- 1SP3E0-	1SP3E1 1SP3E1 2SP3E1-
				Evidence	1 1 1	2 2 2	1 1 1	1 1 1	2 2 2
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 1 1	7 7 7	7 7 7	7 7 7	7 7 7
879	4156	12193949_8	Of these 16 cases, 11 parturients received antibiotic chemoprophylaxis, |A5:**1GP3E3| and 10 of the isolates (91%) were resistant to the drug that was administered, |A5:**2GP3E3-| |A3:**1SP3E3| |A4:**1SP3E3| compared with only one resistant bacteria (20%) in the 5 parturients who did not receive treatment (P =.01). |A5:**3GN3E3| |A1:**1GP3E3| |A2:**1SP3E3| |A3:**2SN3E3| |A4:**2SN3E0|
				Annotation	1GP3E3 1GP3E3 1GP3E3	1SP3E3 1SP3E3 1SP3E3	1SP3E3 1SP3E3 2SN3E3	1SP3E3 1SP3E3 2SN3E0	1GP3E3 2GP3E3- 3GN3E3
				Evidence	4 4 4	4 4 4	4 4 4	4 4 1	4 4 4
				Focus	1 1 1	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	7 7 7	7 7 7	7 7 1	7 7 1	7 7 1
880	8230	11092858_70	Protein samples (1.25 to 5.0 mug) were separated by electrophoresis through a sodium dodecyl sulfate-12% polyacrylamide gel. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
881	9598	11884393_16	Average life spans are 21.9, 30.8, and 35.1 generations, respectively. |A1:**1SP3E0| B, mortality curves for wild type (PSY316AT, circles), sir2:: TRP1 (YDS1594, downward triangles), 2x NPT1 (YDS1544, squares), sir2:: TRP1 2x NPT1 (YDS1573, diamonds), and 5x NPT1 2x SIR2 (YDS1577, upward triangles) on 2% glucose medium. |A1:**2MP3E0| |A2:**1SP3E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E0 2MP3E0	1SP3E0 1SP3E0	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1GP3E3 1GP3E3
				Evidence	1 1	1 1	4 4	4 4	4 4
				Focus	4 2	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	7 7	7 7	7 7
882	4648	9528762_43	RNA was loaded onto the column and incubated for 10 min at room temperature, and the flowthrough was collected. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
883	3054	9736749_119	Log likelihood ratio values, calculated by using the combination of six eigenvectors derived from the stepwise procedure (i.e., 1, 3, 4, 6, 10, and 15) |A4:**1SP3E3| were not correlated with left and right hippocampal volumes in the combined group of schizophrenia or in the control subjects. |A4:**1SN3E3| |A1:**1GN3E3| |A2:**1SP3E3| |A3:**1SN3E3| |A5:**1GN3E3|
				Annotation	1GN3E3 1GN3E3	1SP3E3 1SP3E3	1SN3E3 1SN3E3	1SP3E3 1SN3E3	1GN3E3 1GN3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	1 1	7 7	1 1	7 1	1 1
884	4243	11722920_202	The other bacterial genera detected each comprised less than 5% of the total population. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E1
				Evidence	4	4	4	4	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
885	5198	11675507_31	Here we present a model that combines and integrates bidirectional plasticity of AMPAR by calcium-dependent phosphorylation and dephosphorylation, (LTP/LTD induction) with plasticity of NMDAR subunit composition. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
886	9350	9649508_154	This suggested that the effect on differentiation was specifically attributable to expression of STAT3F. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP2E1|
				Annotation	1SP3E3	1SP3E1	1SP2E0	1SP2E0	1GP2E1
				Evidence	4	2	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	6
887	8642	12571062_2	About 33% of the total bacterioplankton turnover of amino acids, determined with a representative [35] methionine [35]methionine precursor and flow sorting, |A3:**1SP3E2| |A4:**1SP3E2| can be assigned to Prochlorococcus spp. and 3% can be assigned to Synechococcus spp. in the oligotrophic and mesotrophic parts of the Arabian Sea, respectively. |A3:**2SP2E0| |A1:**1SP2E3| |A2:**1SP2E1| |A4:**2SP2E0| |A5:**1GP3E0|
				Annotation	1SP2E3 1SP2E3	1SP2E1 1SP2E1	1SP3E2 2SP2E0	1SP3E2 2SP2E0	1GP3E0 1GP3E0
				Evidence	4 4	2 2	3 1	3 1	1 1
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	6 6	6 6	7 6	7 6	7 7
888	3199	11518719_14	These results, along with NAGly's lack of affinity for the cannabinoid CB1 receptor, the vanilloid VR1 receptor, and the anandamide transporter, |A3:**1SP3E3| |A4:**1SP3E3| support the notion that despite its structural similarity to the endogenous cannabinoid anandamide, |A5:**1SP3E1| NAGly likely functions via molecular and cellular pathways distinct from anandamide and other lipid mediators. |A3:**2SP2E0| |A1:**1SP3E1| |A2:**1SP3E1| |A4:**2SP2E0| |A5:**2SP2E1|
				Annotation	1SP3E1 1SP3E1 1SP3E1	1SP3E1 1SP3E1 1SP3E1	1SP3E3 2SP2E0 2SP2E0	1SP3E3 2SP2E0 2SP2E0	1SP3E1 1SP3E1 2SP2E1
				Evidence	2 2 2	2 2 2	4 1 1	4 1 1	2 2 2
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	4 4 4
				Polarity	7 7 7	7 7 7	7 6 6	7 6 6	7 7 6
889	185	10549623_154	D10/MEKK2-GFP, D10/dnMEKK2-GFP, and noninfected D10 cells were activated by treatment with the stimulatory anti-TCR monoclonal antibody, 3D3 ( Kaye et al. 1983 ). |A1:**1SP3E23| |A2:**1SP3E23+| |A3:**1SP3E2+| |A4:**1SP3E2+| |A5:**1MP3E2|
				Annotation	1SP3E23	1SP3E23+	1SP3E2+	1SP3E2+	1MP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
890	8087	9736749_102	Hippocampal surface deformations that formed the basis for the statistically significant shape difference between the schizophrenia subjects and the controls are shown in Fig. 4. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
891	1883	11056158_29	Most protein folding studies have focused on simple two-state systems, |A5:**1GP3E1| whereas many functionally interesting proteins are likely to show more complex behavior. |A5:**2GP2E0| |A1:**1GP3E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP2E0|
				Annotation	1GP3E0 1GP3E0	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1SP2E0 1SP2E0	1GP3E1 2GP2E0
				Evidence	1 1	1 1	1 1	1 1	2 1
				Focus	1 1	4 4	4 4	4 4	1 1
				Polarity	7 7	6 6	6 6	6 6	7 6
892	4836	12074356_2	Available evidence also suggests that in middle-aged and older hypertensive subjects, pulse pressure may be a better predictor of cardiovascular complications. |A1:**1GP1E1| |A2:**1SP2E1| |A3:**1SP2E1| |A4:**1SP2E1| |A5:**1GP2E1|
				Annotation	1GP1E1	1SP2E1	1SP2E1	1SP2E1	1GP2E1
				Evidence	2	2	2	2	2
				Focus	1	4	4	4	1
				Polarity	5	6	6	6	6
893	1824	12072449_301	Although the tlc1 mutation used in our study |A4:**1SP3E3| and that of M YUNG et al. 2001A, M YUNG et al. 2001B would be expected to result in a similar phenotype as the est1 mutation used by Hackett et al., |A4:**2SP2E2| |A5:**1GP2E23| one difference is that our experiments were performed with survivors, |A4:**3SP3E3| |A5:**2GMP3E3| whereas those of Hackett et al. were done with est1 cells at various stages of the senescence process. |A4:**4SP3E2| |A1:**1GP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A5:**3GMP3E2|
				Annotation	1GP3E3 1GP3E3 1GP3E3 1GP3E3	1SP3E3 1SP3E3 1SP3E3 1SP3E3	1SP3E3 1SP3E3 1SP3E3 1SP3E3	1SP3E3 2SP2E2 3SP3E3 4SP3E2	1GP2E23 1GP2E23 2GMP3E3 3GMP3E2
				Evidence	4 4 4 4	4 4 4 4	4 4 4 4	4 3 4 3	3 3 4 3
				Focus	1 1 1 1	4 4 4 4	4 4 4 4	4 4 4 4	1 1 3 3
				Polarity	7 7 7 7	7 7 7 7	7 7 7 7	7 6 7 7	6 6 7 7
894	4643	10369681_287	We propose that IL-2 starvation induces Ras-Aiolos association and, |A2:**1SP3E3+| |A3:**1SP3E3+| |A4:**1SP3E3+| |A5:**1GP2E3| consequently, inhibition of Bcl-2 expression and the resulting apoptotic cell death. |A2:**2SP3E3-| |A1:**1SP2E3| |A3:**1SP3E0-| |A4:**2SP3E0-| |A5:**2GP3E3-|
				Annotation	1SP2E3 1SP2E3	1SP3E3+ 2SP3E3-	1SP3E3+ 1SP3E0-	1SP3E3+ 2SP3E0-	1GP2E3 2GP3E3-
				Evidence	4 4	4 4	4 1	4 1	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	6 6	7 7	7 7	7 7	6 7
895	1281	11282623_231	Both phenomena were explained by the influence of nisin or carvacrol on membrane composition ( 24, 26, 37, 38). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
896	4134	10913072_301	The gipA ORF is carried in the late operon of the lambdoid phage Gifsy-1. |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E3	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	4	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
897	9282	8612132_173	A PGK-thymidine kinase (PGK- tk) was inserted at one end of the genomic sequence ( Figure 1B). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	2	4	2
				Polarity	7	7	7	7	7
898	6473	11996876_1	This paper aims to gain insight into the medical decision making decision-making processes undergone in a nursing home in response to troubled breathing. |A1:**1GP3E0| |A2:**1GP3E1| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E3|
				Annotation	1GP3E0	1GP3E1	1GP3E3	1GP3E3	1GP3E3
				Evidence	1	2	4	4	4
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
899	5364	10618246_149	Iron is included as a covariable on the x axis. |A1:**1GP3E3| |A2:**1GP3E0| |A3:**1GP3E0| |A4:**1GP3E0| |A5:**1GP3E1|
				Annotation	1GP3E3	1GP3E0	1GP3E0	1GP3E0	1GP3E1
				Evidence	4	1	1	1	2
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
900	6964	12902386_2	Previous work has shown that a wide variety of enzymatic activities of microbial, plant, and animal origin can be assigned to individual polypeptides using in-gel activity staining (zymography). |A1:**1MSP3E1| |A2:**1SP2E1| |A3:**1SP2E1| |A4:**1SP3E1| |A5:**1GMP3E1|
				Annotation	1MSP3E1	1SP2E1	1SP2E1	1SP3E1	1GMP3E1
				Evidence	2	2	2	2	2
				Focus	6	4	4	4	3
				Polarity	7	6	6	7	7
901	1773	10209025_396	Although unlikely, such a scenario might explain why we observe wild-type BrdU labeling intensity of mtDNA several generations after the complete loss of Mgm101-D131Np. |A1:**1SP1E0| |A2:**1SP1E0| |A3:**1SP0E0| |A4:**1SP0E0| |A5:**1SN2E3|
				Annotation	1SP1E0	1SP1E0	1SP0E0	1SP0E0	1SN2E3
				Evidence	1	1	1	1	4
				Focus	4	4	4	4	4
				Polarity	5	5	4	4	2
902	1344	0010224003_148	Only for the most osmosensitive strains ( R. leguminosarum [all biovars], A. rhizogenes, R. etli, and B. japonicum), the growth inhibition by salt stress could not be rescued by the addition of glycine betaine (Table 2), |A1:**1SN3E3-| |A2:**1SN3E3-| |A3:**1SP3E3-| |A4:**1SP3E3-| |A5:**1SN3E3-| although some species like R. leguminosarum showed stimulated glycine betaine uptake under osmotic stress (Table 3). |A1:**2SP3E3+| |A2:**2SP3E3+| |A3:**1SP1E3+| |A4:**2SP1E3+| |A5:**2SP3E3+|
				Annotation	1SN3E3- 2SP3E3+	1SN3E3- 2SP3E3+	1SP3E3- 1SP1E3+	1SP3E3- 2SP1E3+	1SN3E3- 2SP3E3+
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	1 7	1 7	7 5	7 5	1 7
903	3639	12239569_8	We show experimentally that Dpp is widely diffusible in the presence of Sog but tightly localized in its absence, thus validating a central prediction of our theoretical study. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E3	1SP3E3	1SP3E3
				Evidence	4	4	4	4	4
				Focus	1	1	4	4	4
				Polarity	7	7	7	7	7
904	4564	11719191_169	It has been reported that a secreted form of LRP5 can bind Wnt and that an LRP5 mutant lacking the cytoplasmic tail can function as a dominant negative (Mao et al., 2001 ). |A1:**1SP2E2| |A2:**1SP2E2| |A3:**1SP2E2| |A4:**1SP2E2| |A5:**1SP3E2|
				Annotation	1SP2E2	1SP2E2	1SP2E2	1SP2E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	6	6	6	6	7
905	6317	11279070_33	In Drosophila, the composition of the egg chorion appears relatively uniform, |A3:**1SP3E0| |A4:**1SP3E0| although there are some dorsal anterior cells over the oocyte that synthesize specialized chorion structures ( ). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP1E0| |A4:**2SP1E0| |A5:**1SP3E2|
				Annotation	1SP3E2 1SP3E2	1SP3E2 1SP3E2	1SP3E0 1SP1E0	1SP3E0 2SP1E0	1SP3E2 1SP3E2
				Evidence	3 3	3 3	1 1	1 1	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 5	7 5	7 7
906	2431	12225893_3	As both nitric oxide and vasoactive intestinal peptide (VIP) are common messengers to nervous and immune systems mediating secretory and inflammatory responses, |A1:**1GP3E0| |A3:**1SP3E0| |A4:**1SP3E0| we examined nitric oxide synthase (NOS) activity with special focus on VIP-mediated effects in salivary glands of NOD mice. |A1:**2SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**2SP3E3| |A5:**1SP3E3|
				Annotation	1GP3E0 2SP3E3	1SP3E3 1SP3E3	1SP3E0 1SP3E3	1SP3E0 2SP3E3	1SP3E3 1SP3E3
				Evidence	1 4	4 4	1 4	1 4	4 4
				Focus	1 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
907	1315	10535740_367	Cultures were maintained for 5 days in an 18 degrees C incubator. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	4	4	2
				Polarity	7	7	7	7	7
908	7420	10078201_188	Cyclin E/CDK2 and cyclin D1/CDK4-phosphorylated GST-RB are labeled as phosphorylated GST-RB. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1GP3E1
				Evidence	4	4	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
909	1650	10473520_122	Seropositive patients presented a broad spectrum of mental disorders with a predominance of deficit syndrome of schizophrenia, recurrent unipolar depression, and bipolar affective disorders. |A1:**1GP3E3| |A2:**1SP3E1| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1GP3E1|
				Annotation	1GP3E3	1SP3E1	1SP3E1	1SP3E1	1GP3E1
				Evidence	4	2	2	2	2
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
910	6900	9738050_101	Agreement between typing methods was evaluated by calculating concordance, the percent agreement between the methods. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E1|
				Annotation	1GP3E3	1GP3E3	1GP3E3	1GP3E3	1GP3E1
				Evidence	4	4	4	4	2
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
911	8332	12376529_14	On the basis of these findings, we suggested that the requirement for the DRVPHSRN sequence may only be critical for integrin binding in the case of an isolated FIII9-10 pair. |A1:**1SP3E3| |A2:**1SP1E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP2E3|
				Annotation	1SP3E3	1SP1E3	1SP2E3	1SP2E3	1GP2E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	5	6	6	6
912	6573	11591687_197	Polyclonal antibody raised against purified RsbQ was used to probe Western blots of whole cell whole-cell extracts separated by SDS polyacrylamide SDS-polyacrylamide gel electrophoresis. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
913	4097	9030532_74	The forms of PLP-A, PLP-B, PLP-C, d/t PRP, and PL-Iv present in the unbound fraction from WGA-Sepharose were bound by ConA-Sepharose, indicating they are glycosylated (Fig. 7, ConA-Sepharose). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
914	3127	12015971_200	Since DKK1 is a specific inhibitor of WNT coreceptors of the LRP family that are required for activation of the canonical WNT signaling pathway (Bafico et al., 2001; Mao et al., 2001 ; Semenov et al., 2001 ; Zorn, 2001 ), |A1:**1SP3E2| |A2:**1SP3E2-| |A3:**1SP3E2+| |A4:**1SP3E2+| |A5:**1SP3E2| our results indicate that canonical WNT signals are universally required for initiation of follicle development. |A1:**2SP3E3| |A2:**2SP3E3| |A3:**1SP3E3| |A4:**2SP3E3| |A5:**2SP3E3|
				Annotation	1SP3E2 2SP3E3	1SP3E2- 2SP3E3	1SP3E2+ 1SP3E3	1SP3E2+ 2SP3E3	1SP3E2 2SP3E3
				Evidence	3 4	3 4	3 4	3 4	3 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
915	4861	11208805_43	Knockout mutations of ripX, recA, and spoIIIE have been described previously ( 34). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1MP3E2| |A4:**1MP3E2| |A5:**1GP3E2|
				Annotation	1SP3E2	1SP3E2	1MP3E2	1MP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	2	2	1
				Polarity	7	7	7	7	7
916	8546	10625627_49	Interaction of KRC Antisera with the Complex Formed by Sb and p200-- Other KRC family members have been reported to bind kappaB-like DNA sequences. |A1:**1SP3E1| |A2:**1SP3E1| |A3:**1SP2E1| |A4:**1SP2E1| |A5:**1SP3E2|
				Annotation	1SP3E1	1SP3E1	1SP2E1	1SP2E1	1SP3E2
				Evidence	2	2	2	2	3
				Focus	4	4	4	4	4
				Polarity	7	7	6	6	7
917	2516	10454379_57	Brains were dissected under saline, dehydrated, cleared in methylsalicylate, and examined under a fluorescence microscope for the distribution and localization of LY. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E1| |A4:**1MP3E1| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E1	1MP3E1	1MP3E3
				Evidence	4	4	2	2	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
918	5893	10549288_57	In contrast, substantial changes occur in the conformation of the 190s loop (residues 195-201) connecting strands C and D and in the 150s loop (residues 154-162) linking strands A and A. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
919	6841	12479820_84	gp33-1Lo cells were treated with 4-OHTAM for 4 days to generate gp33-1Hi cells. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E1| |A4:**1MP3E1| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E1	1MP3E1	1MP3E3
				Evidence	4	4	2	2	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
920	6682	10790380_207	If the apparent lack of host immune pressure can be abrogated by induction of enhanced effector function, then the lack of diversity in protein targets may be cause for optimism in the difficult fight to control globa tuberculosis. |A1:**1SP1E0| |A2:**1SP1E0| |A3:**1SP1E0| |A4:**1SP2E0| |A5:**1GP2E0|
				Annotation	1SP1E0	1SP1E0	1SP1E0	1SP2E0	1GP2E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	5	5	5	6	6
921	9613	10835000_8	While invasive amebiasis presents as amebic colitis or amebic liver abscess (ALA) (18). |A1:**1GP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2|
				Annotation	1GP3E2	1SP3E2	1SP3E2	1SP3E2	1GP3E2
				Evidence	3	3	3	3	3
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
922	9100	10037739_230	Thus, in these cells, Bcl-2 apparently does not abrogate p53-mediated transcription of genes involved in inhibiting cell proliferation such as p21/waf-1. |A1:**1SP3E1| |A2:**1SN3E1-| |A3:**1SN3E0-| |A4:**1SN3E0-| |A5:**1SN3E1-|
				Annotation	1SP3E1	1SN3E1-	1SN3E0-	1SN3E0-	1SN3E1-
				Evidence	2	2	1	1	2
				Focus	4	4	4	4	4
				Polarity	7	1	1	1	1
923	2973	9487133_198	The Och1-HA staining pattern in the arf1delta mutant was similar to that of Mnn1p: |A1:**1SP3E3| most of the cells exhibited ring-shaped structures (Figure 5E). |A1:**2SP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP3E3|
				Annotation	1SP3E3 2SP3E3	1SP3E3 1SP3E3	1SP2E3 1SP2E3	1SP2E3 1SP2E3	1GP3E3 1GP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 7	7 7	6 6	6 6	7 7
924	4740	10882101_275	Collectively, these data are consistent with the idea that TAB2 participates in IL-1 signaling by linking TAK1 with the upstream component TRAF6. |A1:**1SP3E0| |A2:**1SP3E1| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP3E1|
				Annotation	1SP3E0	1SP3E1	1SP2E3	1SP2E3	1GP3E1
				Evidence	1	2	4	4	2
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	7
925	5117	12161657_80	These results show that Wnt signaling can trigger neural crest cell induction, |A5:**1SP3E3+| even in the absence of factors required to achieve a similar outcome by BMP signaling (Fig. 2). |A5:**2SP3E3-| |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3+| |A4:**1SP3E3+|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3+ 1SP3E3+	1SP3E3+ 1SP3E3+	1SP3E3+ 2SP3E3-
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
926	4093	11278841_36	Retrieval of furin from endosomal to TGN compartments was also shown to be dependent on phosphorylation/dephosphorylation of its cytoplasmic domain ( ). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E1| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP3E1	1SP3E2
				Evidence	3	3	3	2	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
927	2716	9488388_213	The primers used for the beta-galactosidase experiments, RER36 and RER40, are shown. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E1	1MP3E3	1MP3E3	1GP3E1
				Evidence	4	2	4	4	2
				Focus	4	4	2	2	1
				Polarity	7	7	7	7	7
928	1595	11781330_1	Feltri et al. (2001)(this issue) succeed in disrupting beta1 integrin specifically in Schwann cells, and in so doing, |A1:**1SP3E3| demonstrate that it is required for normal myelination. |A1:**2SP3E3| |A2:**1SP3E2| |A3:**1SP3E1| |A4:**1SP3E3| |A5:**1SP3E2|
				Annotation	1SP3E3 2SP3E3	1SP3E2 1SP3E2	1SP3E1 1SP3E1	1SP3E3 1SP3E3	1SP3E2 1SP3E2
				Evidence	4 4	3 3	2 2	4 4	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
929	901	11930055_1	PURPOSE: To evaluate the safety and effectiveness of computed tomography (CT)-guided percutaneous ethanol injection (PEI) for the treatment of hepatocellular carcinoma (HCC) not detectable with ultrasonography (US). |A1:**1SN3E0| |A2:**1SN3E0| |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1MN3E0|
				Annotation	1SN3E0	1SN3E0	1SN3E0	1SN3E0	1MN3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	2
				Polarity	1	1	1	1	1
930	5034	10911994_164	FLS2 mRNA was detected in all the tissues tested (Figure 5A) |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| and was not affected by flagellin treatment (Figure 5B), |A3:**2SN3E3| |A4:**2SN3E3| |A5:**1GN3E3| suggesting that FLS2 is part of a preexisting recognition system. |A1:**2SN3E3| |A2:**2SN3E3| |A3:**3SP2E0| |A4:**3SP2E0| |A5:**1GP2E3|
				Annotation	1SP3E3 2SN3E3 2SN3E3	1SP3E3 2SN3E3 2SN3E3	1SP3E3 2SN3E3 3SP2E0	1SP3E3 2SN3E3 3SP2E0	1GN3E3 1GN3E3 1GP2E3
				Evidence	4 4 4	4 4 4	4 4 1	4 4 1	4 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	7 1 1	7 1 1	7 1 6	7 1 6	1 1 6
931	2221	9139704_11	This conformational hypothesis is consistent with the lack of a consensus sequence for proteoglycan biosynthesis initiation (, ) |A1:**1SP2E2| |A2:**1SP2E2| |A4:**1SP2E1| and by the experiments performed with decorin, a proteoglycan in which the primary structure of the protein core surrounding the sugar acceptor serine residue can be changed without appreciable modification in the glycosaminoglycan ( ). |A1:**2SP2E2| |A2:**2SP2E2| |A3:**1SP2E2| |A4:**2SP2E3| |A5:**1GP3E2|
				Annotation	1SP2E2 2SP2E2	1SP2E2 2SP2E2	1SP2E2 1SP2E2	1SP2E1 2SP2E3	1GP3E2 1GP3E2
				Evidence	3 3	3 3	3 3	2 4	3 3
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	6 6	6 6	6 6	6 6	7 7
932	8315	11598035_171	Trichloroacetic acid-precipitated culture supernatants (sup) and bacterial cell lysates (whole) derived from the same amount of O157Cu with either pHis-toxB( SacI) derivatives or pQE30 (used as a control) were resolved by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue (bottom photo) or transferred to a nitrocellulose membrane and probed with polyclonal rabbit antiserum specific to each protein indicated at the right. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
933	3525	11387340_2	Important for these events is a family of proteases, caspases, |A5:**1SP3E1| which are activated by a proteolytic cleavage cascade and drive apoptosis by targeting key proteins within the cell. |A5:**2SP3E0| |A1:**1SP3E3| |A2:**1SP3E1+| |A3:**1SP3E0| |A4:**1SP3E0|
				Annotation	1SP3E3 1SP3E3	1SP3E1+ 1SP3E1+	1SP3E0 1SP3E0	1SP3E0 1SP3E0	1SP3E1 2SP3E0
				Evidence	4 4	2 2	1 1	1 1	2 1
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 7	7 7	7 7
934	1002	10835394_70	The phenotypes of mxp19 (Fig 1B) |A2:**1SP3E3| and mxp170 (data not shown) homozygotes and hemizygotes (data not shown) are identical, |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3| suggesting that mxp19 and mxp170 are null alleles. |A2:**2SP3E1| |A1:**1SP3E3| |A3:**1SP2E0| |A4:**2SP2E0| |A5:**2GP2E3|
				Annotation	1SP3E3 1SP3E3 1SP3E3	1SP3E3 2SP3E1 2SP3E1	1SP3E3 1SP3E3 1SP2E0	1SP3E3 1SP3E3 2SP2E0	1GP3E3 1GP3E3 2GP2E3
				Evidence	4 4 4	4 2 2	4 4 1	4 4 1	4 4 4
				Focus	4 4 4	4 4 4	4 4 4	4 4 4	1 1 1
				Polarity	7 7 7	7 7 7	7 7 6	7 7 6	7 7 6
935	1130	10986243_33	According to previous studies (11) this fragment carried sequences sufficient to constitute a RepA binding site. |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP2E2| |A4:**1SP2E2| |A5:**1SP3E2|
				Annotation	1SP3E2	1SP3E2	1SP2E2	1SP2E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	6	6	7
936	9339	10617654_5	Furthermore, the metal binding motif in the yeast Atox1 protein, which is common to bacterial metal transporter proteins ( , ), is conserved in both the rat and human Atox1 protein. |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E21|
				Annotation	1SP3E2	1SP3E2	1SP3E0	1SP3E0	1GP3E21
				Evidence	3	3	1	1	3
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
937	4856	11114897_228	In the gammadelta resolvase-DNA cocrystal structure, a 26 degrees kink at the gammadelta resolvase Asn-127 (corresponding to the Hin Leu-125) in the structure of one of the two dimerization helices was observed (32) (Fig. 5). |A1:**1GP3E23| |A2:**1SP3E23| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP3E3|
				Annotation	1GP3E23	1SP3E23	1SP3E3	1SP3E3	1SP3E3
				Evidence	3	3	4	4	4
				Focus	1	4	4	4	4
				Polarity	7	7	7	7	7
938	2595	11319104_76	Nocardia farcinica was used as the outgroup to root the tree. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1GP3E1|
				Annotation	1GP3E3	1GP3E3	1SP3E1	1SP3E1	1GP3E1
				Evidence	4	4	2	2	2
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
939	3865	9446604_96	These recombinant forms of FLICE were used to establish whether the zymogen did indeed possess enzymatic activity. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP1E0| |A4:**1SP1E0| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E3	1SP1E0	1SP1E0	1GP3E1
				Evidence	4	4	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	5	5	7
940	2351	9353253_219	The sections were stained both with hematoxylin and eosin and for TRAP activity and the bone volume (amount of bone matrix as a percentage of the cancellous space), |A1:**1SP3E3| and osteoclast numbers (expressed per millimeter of the cancellous bone surface) in the cancellous space of the long bones were measured, as described previously (Boyce et al. 1992 ). |A1:**2SP3E23| |A2:**1SP3E23| |A3:**1MP3E1| |A4:**1MP3E1| |A5:**1MP3E23|
				Annotation	1SP3E3 2SP3E23	1SP3E23 1SP3E23	1MP3E1 1MP3E1	1MP3E1 1MP3E1	1MP3E23 1MP3E23
				Evidence	4 3	3 3	2 2	2 2	3 3
				Focus	4 4	4 4	2 2	2 2	2 2
				Polarity	7 7	7 7	7 7	7 7	7 7
941	7031	9362061_354	The fully glycosylated precursor then becomes sulfated in the trans-GolgiTGN. |A1:**1GP3E3| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1GP3E3	1SP3E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	4	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	7	7	7	7	7
942	5167	10648516_125	The possible ORFs and known genes are labeled, and the locations of the integrated forms of pEG920 insertion vectors, pY5D in orf3, pY11D in prmN1, and pY17 in mobN1, are indicated. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E1	1SP3E3	1SP3E3	1GP3E1
				Evidence	4	2	4	4	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
943	3262	10552999_102	The antioxidant protection in plasma was determined as the resistance of plasma LDL to copper-oxidation and is reported as the lag time between the addition of copper ions and the onset of the rapid phase of oxidation (38). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2|
				Annotation	1SP3E23	1SP3E23	1SP3E2	1SP3E2	1SP3E2
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
944	9594	11102448_34	In the presence of a PKC-specific substrate, the kinase activity of BHL-stimulated samples was decreased by 20%. |A1:**1SP3E3-| |A2:**1SP3E3-| |A3:**1SP3E0-| |A4:**1SP3E0-| |A5:**1GP3E1-|
				Annotation	1SP3E3-	1SP3E3-	1SP3E0-	1SP3E0-	1GP3E1-
				Evidence	4	4	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
945	7019	12454075_156	If wCauA induces CI in C. cautella, our data indicate that wCauA causes two distinct phenotypes in the two different hosts. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP2E3	1SP2E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	7
946	2288	9199932_52	In addition, a previously unknown composite transposon of 4447 bp was identified in the human insert of cosmid C12. |A1:**1SP3E3| |A2:**1SP3E1| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E1	1SP3E1	1SP3E1	1GP3E1
				Evidence	4	2	2	2	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
947	589	9614213_125	Fig. 2A shows the double-reciprocal plot of 1/ k versus 1/[puromycin] for anisomycin concentrations ranging from 1 x 10 6 to 20 x 10 6M. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
948	5585	9525867_132	Consistent with this, we have shown recently that the caspase-9 mutant can inhibit Bax-induced apoptosis and processing of caspase-3 (5). |A1:**1SN3E2| |A2:**1SN3E2| |A3:**1SP3E2-| |A4:**1SP3E2-| |A5:**1GP3E23-|
				Annotation	1SN3E2	1SN3E2	1SP3E2-	1SP3E2-	1GP3E23-
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	1	1	7	7	7
949	5817	11069898_16	To reiterate, CK2 has been proposed to have a major functional role in growth-related activities, especially in stimulation of cell growth ( , ). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP2E2|
				Annotation	1SP3E2	1SP3E2	1SP2E0	1SP2E0	1GP2E2
				Evidence	3	3	1	1	3
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	6
950	1670	10102266_312	The homogenate was centrifuged at 35,000 rpm in a 45 Ti rotor for 2 hr at 4 degrees C. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
951	4663	9844016_116	There was a small reduction (16.9% plus-or-minus 12%) in gamma2L mRNA in the same samples of prefrontal cortex from schizophrenics (Fig. 5 D), |A3:**1SP3E3-| |A4:**1SP3E3-| but this was not significant ( P > 0.05). |A3:**1SN3E0| |A1:**1SN3E3-| |A2:**1SN3E3-| |A4:**1SN3E0| |A5:**1GN3E3-|
				Annotation	1SN3E3- 1SN3E3-	1SN3E3- 1SN3E3-	1SP3E3- 1SN3E0	1SP3E3- 1SN3E0	1GN3E3- 1GN3E3-
				Evidence	4 4	4 4	4 1	4 1	4 4
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	1 1	1 1	7 1	7 1	1 1
952	5113	10880518_16	If, as our data suggest, cap 4 biosynthesis is cotranscriptional, |A3:**1SP3E3| |A4:**1SP3E3| it is tantalizing to speculate that the cap 4 methyltransferases engage in an interaction with the SL RNA transcriptional complex. |A3:**1SP0E0| |A1:**1SP3E3| |A2:**1SP3E3| |A4:**1SP0E0| |A5:**1SP0E3|
				Annotation	1SP3E3 1SP3E3	1SP3E3 1SP3E3	1SP3E3 1SP0E0	1SP3E3 1SP0E0	1SP0E3 1SP0E3
				Evidence	4 4	4 4	4 1	4 1	4 4
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	7 4	7 4	4 4
953	3825	11867725_23	In prior studies of twins discordant for schizophrenia, both the patients and their unaffected MZ co-twins manifested lower than normal whole-brain, hemispheric, and/or frontal lobe gray-matter volumes, suggesting that genetic factors contribute to cortical gray-matter deficits in schizophrenia (23-25). |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP2E2| |A5:**1SP3E2-|
				Annotation	1SP3E2	1SP3E2	1SP3E2	1SP2E2	1SP3E2-
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	6	7
954	7928	10473520_63	A total of 917 sera from voluntary blood donors were tested for anti-BDV p40 and p24 antibodies by ECLIA. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1GP3E3|
				Annotation	1MP3E3	1SP3E3	1SP3E1	1SP3E1	1GP3E3
				Evidence	4	4	2	2	4
				Focus	2	4	4	4	1
				Polarity	7	7	7	7	7
955	1603	10913072_45	PCR primers 60 nucleotides (nt) long were synthesized with 40 nt on the 5' ends corresponding to the ends of the desired deletions. |A1:**1SP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	2	2	2	2
				Polarity	7	7	7	7	7
956	7215	9145925_176	Some polyamine analogs, such as 1,10-diaminodecane, seem to act as classic channel blockers, producing a complete block of macroscopic currents (47, 48). |A1:**1SP1E2| |A2:**1SP1E2| |A3:**1SP2E2| |A4:**1SP2E2| |A5:**1GP2E2-|
				Annotation	1SP1E2	1SP1E2	1SP2E2	1SP2E2	1GP2E2-
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	1
				Polarity	5	5	6	6	6
957	6191	12244136_2	However, the relative contribution of these receptors for containing M. tuberculosis infection has remained unexplored in vivo. |A1:**1SP3E1| |A2:**1SN3E0| |A3:**1SP0E0| |A4:**1SP0E0| |A5:**1GP3E0|
				Annotation	1SP3E1	1SN3E0	1SP0E0	1SP0E0	1GP3E0
				Evidence	2	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	1	4	4	7
958	7681	12124177_335	Pools of Ba/F3 cell lines transfected to express BCR/ABL-WT, BCR/ABL-Y177F, BCR/ABL- CRKL, and BCR/ABL-F CRKL (all in the backbone of p210 BCR/ABL) were selected for G418 resistance (2 mg/ml). |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1MP3E1| |A4:**1MP3E1| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1MP3E1	1MP3E1	1MP3E3
				Evidence	4	4	2	2	4
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
959	9708	12932352_189	Spontaneous peptide binding in the absence of DM (35,000-65,000 counts, depending on pH) was subtracted. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E0	1SP3E0	1MP3E3
				Evidence	4	4	1	1	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
960	1422	11473988_52	Preliminary titration experiments revealed that each immunoreagent attained an optimal immunofluorescent signal at the concentration supplied by the manufacturer. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1GP3E3|
				Annotation	1GP3E3	1GP3E3	1SP3E1	1SP3E1	1GP3E3
				Evidence	4	4	2	2	4
				Focus	1	1	4	4	1
				Polarity	7	7	7	7	7
961	745	11159738_7	Taken together, our results suggest that DCA can stimulate pro-apoptotic and anti-apoptotic signaling pathways and that sensitivity to DCA-induced apoptosis can be modulated by the ERK MAP kinase. |A1:**1SP2E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1SP2E3+|
				Annotation	1SP2E3	1SP3E3	1SP3E3	1SP3E3	1SP2E3+
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	4
				Polarity	6	7	7	7	6
962	2440	12586720_251	When working with young, vegetative plant materials, the molecular markers described may be more effective than GC chromatograms in genotyping plants for their chemotype. |A1:**1SP1E0| |A2:**1SP1E0| |A3:**1SP2E1| |A4:**1SP2E1| |A5:**1GP3E0|
				Annotation	1SP1E0	1SP1E0	1SP2E1	1SP2E1	1GP3E0
				Evidence	1	1	2	2	1
				Focus	4	4	4	4	1
				Polarity	5	5	6	6	7
963	5368	12408810_54	As shown in Figures 2B and 2C, the lasR, rhlR, lasRrhlR, and pilA mutants formed very robust biofilms under aerobic conditions, even better than did wild-type bacteria. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
964	2183	11282627_68	R. palustris and T. aromatica cultures were grown with similar benzoate concentrations, and the samples were processed as described above. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1MP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	2
				Polarity	7	7	7	7	7
965	13	10428033_161	Thus, a simple purification of the intact holoenzyme can be effected using nickel affinity chromatography (see Experimental Procedures). |A1:**1MP2E3| |A2:**1MP2E1| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP3E0|
				Annotation	1MP2E3	1MP2E1	1SP2E0	1SP2E0	1GP3E0
				Evidence	4	2	1	1	1
				Focus	2	2	4	4	1
				Polarity	6	6	6	6	7
966	5880	8647863_19	An additional role for integrins in promoting metastasis may involve generation of growth promoting signals. |A1:**1SP1E0| |A2:**1SP1E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1SP2E0|
				Annotation	1SP1E0	1SP1E0	1SP2E0	1SP2E0	1SP2E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	5	5	6	6	6
967	4916	11086983_385	Based on the detection of expressed genes, the hybridizations were as successful as the human sample hybridizations. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E1	1SP3E1	1GP3E1
				Evidence	4	4	2	2	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
968	5739	11051552_213	Our results suggest that two distinct pathways govern iron homeostasis in enteric bacteria. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
969	3682	12606770_27	The amino acid residues that define the C1a and C1b regions of the C1 domain and C2a and C2b regions of C2 domain are shown |A5:**1GP3E3| C, Immunoblot (lanes 1-5) and silver stained SDS-PAGE gel (lane 6) analysis of the soluble fusion proteins. |A5:**2MP3E3| |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1MP3E3| |A4:**1MP3E3|
				Annotation	1MP3E3 1MP3E3	1SP3E3 1SP3E3	1MP3E3 1MP3E3	1MP3E3 1MP3E3	1GP3E3 2MP3E3
				Evidence	4 4	4 4	4 4	4 4	4 4
				Focus	2 2	4 4	2 2	2 2	1 2
				Polarity	7 7	7 7	7 7	7 7	7 7
970	7305	11254587_222	Another difficulty is the fact that polysaccharides are poorly immunogenic and produce a short-term T-cell-independent response. |A1:**1SP3E0| |A2:**1SP1E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP1E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	5	7	7	7
971	741	8626459_25	First, thiophosphorylated precursor proteins were used for import. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E1|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E1
				Evidence	4	4	4	4	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
972	152	12820963_321	A set of oligonucleotides (TGAGTTCCGACACTCCATCAGGAATTTCGAAGCTTGGAAATTCCTGATGGAGTGTCGGAACTCACCGTTTTTT and GATCAAAAAACGGTGAGTTCCGACACTCCATCAGGAATTTCCAAGCTTCGAAATTCCTGATGGAGTGTCGGAACTCACG) were annealed and ligated into piNEO cut with BseRI/amHI to generate piNEO-4E-BP1. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	4	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
973	3698	9603979_220	hsp70 also interacts with other steroid receptors, |A1:**1SP3E0| |A2:**1SP3E0| |A5:**1GP3E0| suggesting that RAP46 may regulate the activity of these receptors as well. |A1:**2SP1E0| |A2:**1SP1E0| |A3:**1SP2E1| |A4:**1SP2E1| |A5:**2GP2E0|
				Annotation	1SP3E0 2SP1E0	1SP3E0 1SP1E0	1SP2E1 1SP2E1	1SP2E1 1SP2E1	1GP3E0 2GP2E0
				Evidence	1 1	1 1	2 2	2 2	1 1
				Focus	4 4	4 4	4 4	4 4	1 1
				Polarity	7 5	7 5	6 6	6 6	7 6
974	5447	12702649_26	Finally, the expression of dickkopf 1, a potent diffusible inhibitor of Wnt action, in the skin of transgenic mice produces a complete failure of placode formation prior to morphological or molecular signs of hair differentiation (Andl et al., 2002 ). |A1:**1SP3E2| |A2:**1SP3E2-| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2-|
				Annotation	1SP3E2	1SP3E2-	1SP3E2	1SP3E2	1SP3E2-
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
975	9381	12586070_149	Miranda then translocates from the apical to the basal cortex. |A1:**1SP3E0| |A2:**1SP1E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1GP3E0|
				Annotation	1SP3E0	1SP1E0	1SP3E0	1SP3E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	1
				Polarity	7	5	7	7	7
976	7440	12086874_289	Furthermore, as stated above, mice may die of expansive astrocytoma before significant tumor progression occurs. |A1:**1SP1E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP2E1|
				Annotation	1SP1E0	1SP2E0	1SP2E0	1SP2E0	1GP2E1
				Evidence	1	1	1	1	2
				Focus	4	4	4	4	1
				Polarity	5	6	6	6	6
977	7322	10768974_74	The membranes were incubated with primary rabbit polyclonal antibody against MKP-1 (Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.) or human c-Jun (no. 9162; New England BioLabs, Inc., Beverly, Mass.), washed, and then blotted with horseradish peroxidase-conjugated anti-rabbit IgG secondary antibody (New England BioLabs). |A1:**1MP3E2| |A2:**1MP3E3| |A3:**1MP3E3| |A4:**1MP3E3| |A5:**1MP3E3|
				Annotation	1MP3E2	1MP3E3	1MP3E3	1MP3E3	1MP3E3
				Evidence	3	4	4	4	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
978	148	9614212_50	When multiple agonist concentrations were applied to the same oocyte, the maximal increase in ICl amplitude varied considerably among different oocytes. |A1:**1SP3E3+| |A2:**1SP3E3+| |A3:**1SP3E0+| |A4:**1SP3E0+| |A5:**1GP3E1|
				Annotation	1SP3E3+	1SP3E3+	1SP3E0+	1SP3E0+	1GP3E1
				Evidence	4	4	1	1	2
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
979	2179	12057845_1	Peptidylarginine deiminases (PADs) are a group of posttranslational modification enzymes that convert protein arginine residues to citrulline residues. |A1:**1SP3E0| |A2:**1SP3E0| |A3:**1SP3E0| |A4:**1SP3E0| |A5:**1SP3E0|
				Annotation	1SP3E0	1SP3E0	1SP3E0	1SP3E0	1SP3E0
				Evidence	1	1	1	1	1
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
980	4412	11375170_150	The amounts of AMO were almost equimolar with the amounts of glucoamylase (visible as a band at approximately 80 kDa), indicating that degradation was minimal. |A1:**1SP3E3-| |A2:**1SP3E3-| |A3:**1SP2E3-| |A4:**1SP2E3-| |A5:**1GP3E3|
				Annotation	1SP3E3-	1SP3E3-	1SP2E3-	1SP2E3-	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	6	6	7
981	4239	11441136_115	To our knowledge, this is the first report of high levels of 7- and 8-dehydrocholesterol in a mammalian tissue except in pathophysiological conditions, drug interventions, or elevated concentrations of 7-dehydrocholesterol in human skin, serving as a precursor for vitamin D formation (28). |A1:**1SP2E2| |A2:**1SP2E2| |A3:**1SP2E2| |A4:**1SP2E2| |A5:**1SP3E23|
				Annotation	1SP2E2	1SP2E2	1SP2E2	1SP2E2	1SP3E23
				Evidence	3	3	3	3	3
				Focus	4	4	4	4	4
				Polarity	6	6	6	6	7
982	9425	10993827_12	The availability of reliable RIA procedures should aid in the further understanding of the role of BSP proteins in sperm function as well as their effect on sperm cryopreservation. |A1:**1GP2E0| |A2:**1SP2E0| |A3:**1SP2E0| |A4:**1SP2E0| |A5:**1GP3E0|
				Annotation	1GP2E0	1SP2E0	1SP2E0	1SP2E0	1GP3E0
				Evidence	1	1	1	1	1
				Focus	1	4	4	4	1
				Polarity	6	6	6	6	7
983	3336	12618190_15	Streptomycin interacts with the central domain of 16S ribosomal RNA [1] |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP3E2| |A4:**1SP3E2| |A5:**1SP3E2| and also inhibits group I intron splicing [3]. |A1:**2SN3E2| |A2:**2SP2E2-| |A3:**1SP3E2-| |A4:**2SP3E2-| |A5:**2SP3E2-|
				Annotation	1SP3E2 2SN3E2	1SP3E2 2SP2E2-	1SP3E2 1SP3E2-	1SP3E2 2SP3E2-	1SP3E2 2SP3E2-
				Evidence	3 3	3 3	3 3	3 3	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 1	7 6	7 7	7 7	7 7
984	5121	9971749_89	Immunoprecipitation with indicated mAbs (10 mug) adsorbed on protein A-Sepharose 3 h at 4 degrees C under agitation was then performed on precleared lysates. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E1| |A4:**1MP3E1| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E1	1MP3E1	1MP3E3
				Evidence	4	4	2	2	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
985	9957	10102266_351	The bands were reduced and alkylated with isopropylacetamide (Krutzsch and Inman, 1993 ) followed by digestion in 20 mul of 0.05 M ammonium bicarbonate containing 0.5% Zwitergent 3-16 (Calbiochem) with 0.2 mug of trypsin (Frozen Promega Modified) or Lys-C (Wako) at 37 degrees C for 17 hr (Lui et al., 1996 ). |A1:**1SP3E23| |A2:**1MP3E23| |A3:**1MP3E1| |A4:**1MP3E1| |A5:**1MP3E23|
				Annotation	1SP3E23	1MP3E23	1MP3E1	1MP3E1	1MP3E23
				Evidence	3	3	2	2	3
				Focus	4	2	2	2	2
				Polarity	7	7	7	7	7
986	9930	10799441_130	Finally, the sensitivity of T-cell detection by this technology may be well below that achieved with more conventional methods for single-epitope-specific T cells, as discussed above. |A1:**1SP1E1| |A2:**1SP1E1| |A3:**1SP2E3| |A4:**1SP2E3| |A5:**1GP2E3|
				Annotation	1SP1E1	1SP1E1	1SP2E3	1SP2E3	1GP2E3
				Evidence	2	2	4	4	4
				Focus	4	4	4	4	1
				Polarity	5	5	6	6	6
987	5660	8621623_20	Using GST-TEF-1 pull-down assays we confirmed the observation of Gruda et al.(1993), |A2:**1SP3E23| |A3:**1MP3E2| |A4:**1MP3E2| demonstrating that TEF-1 specifically interacts with hTBP, |A1:**1SP3E23| |A5:**1GP3E23| but not hTFIIB or as a control the human TRbeta receptor (Fig. 5 C). |A1:**2SN3E3| |A2:**1SP3E3| |A3:**1SN3E3| |A4:**2SN3E3| |A5:**2GN3E3|
				Annotation	1SP3E23 1SP3E23 2SN3E3	1SP3E23 1SP3E3 1SP3E3	1MP3E2 1SN3E3 1SN3E3	1MP3E2 2SN3E3 2SN3E3	1GP3E23 1GP3E23 2GN3E3
				Evidence	3 3 4	3 4 4	3 4 4	3 4 4	3 3 4
				Focus	4 4 4	4 4 4	2 4 4	2 4 4	1 1 1
				Polarity	7 7 1	7 7 7	7 1 1	7 1 1	7 7 1
988	1931	12765611_174	To determine if calpain activity correlates with PY levels in neurons, |A3:**1SP0E0| |A4:**1SP0E0| we used immunocytochemistry to compare growth cone PY levels on substrata that activate calpain to different degrees. |A3:**2SP3E1| |A1:**1MP2E3| |A2:**1SP2E3+| |A4:**2SP3E1| |A5:**1GMP3E3|
				Annotation	1MP2E3 1MP2E3	1SP2E3+ 1SP2E3+	1SP0E0 2SP3E1	1SP0E0 2SP3E1	1GMP3E3 1GMP3E3
				Evidence	4 4	4 4	1 2	1 2	4 4
				Focus	2 2	4 4	4 4	4 4	3 3
				Polarity	6 6	6 6	4 7	4 7	7 7
989	5833	12569095_49	The first patch is perpendicular to the hUbc13.hMms2 interface, and is composed of residues at the C-terminal end of alpha1 and the loop that joins alpha1 to beta1 (Glu-20, Glu-21, Gly-22, Gln-23, Lys-24, Gly-25, Val-26, Gly-27, Gly-29, and Val-31), portions of beta1 (Ser-32, Trp-33, and Leu-35), beta2 (Thr-47, Gly-48, and Met-49), and beta3 (Arg-61, Tyr-63, and Leu-65). |A1:**1SP3E3| |A2:**1SP3E0| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E0|
				Annotation	1SP3E3	1SP3E0	1SP3E3	1SP3E3	1GP3E0
				Evidence	4	1	4	4	1
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
990	2876	9916061_29	Although a number of research groups have investigated these aspects for Porphyromonas gingivalis ( 2, 30), |A3:**1SP3E2| |A1:**1GP3E2| |A2:**1SP3E2| |A4:**1SP3E2| |A5:**1GP3E2| to our knowledge nothing has been done concerning other black-pigmented anaerobic bacteria. |A3:**2SN3E3| |A1:**2SN3E1| |A2:**2SN3E1| |A4:**2SN3E3| |A5:**2GN3E3|
				Annotation	1GP3E2 2SN3E1	1SP3E2 2SN3E1	1SP3E2 2SN3E3	1SP3E2 2SN3E3	1GP3E2 2GN3E3
				Evidence	3 2	3 2	3 4	3 4	3 4
				Focus	1 4	4 4	4 4	4 4	1 1
				Polarity	7 1	7 1	7 1	7 1	7 1
991	7996	11577081_26	Upon treatment with TNF-alpha, cells transfected with different IG20 isoforms showed enhanced ERK and NF-kappaB activation. |A1:**1SP3E3+| |A2:**1SP3E3| |A3:**1MP3E3+| |A4:**1MP3E3+| |A5:**1GP3E3+|
				Annotation	1SP3E3+	1SP3E3	1MP3E3+	1MP3E3+	1GP3E3+
				Evidence	4	4	4	4	4
				Focus	4	4	2	2	1
				Polarity	7	7	7	7	7
992	765	9362059_80	Telomerase-containing extracts were prepared from mated Euplotes cells as described by Bednenko et al. (1997). |A1:**1SP3E23| |A2:**1SP3E23| |A3:**1MP3E2| |A4:**1MP3E2| |A5:**1MP3E23|
				Annotation	1SP3E23	1SP3E23	1MP3E2	1MP3E2	1MP3E23
				Evidence	3	3	3	3	3
				Focus	4	4	2	2	2
				Polarity	7	7	7	7	7
993	6729	9316879_40	The descending colons were exposed, and macroscopic inflammation was assessed according to the criteria described in table 1. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E3| |A4:**1SP3E3| |A5:**1GP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E3	1SP3E3	1GP3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	7	7	7	7	7
994	7924	9925650_164	Manuscript received July 13, 1998; and in revised form October 19, 1998. |A1:**1GP3E3| |A2:**1GP3E3| |A3:**1GP3E3| |A4:**1GP3E3| |A5:**1GP3E0|
				Annotation	1GP3E3	1GP3E3	1GP3E3	1GP3E3	1GP3E0
				Evidence	4	4	4	4	1
				Focus	1	1	1	1	1
				Polarity	7	7	7	7	7
995	3308	10882653_9	The sequence information on the SDAV S-protein gene was applied to a differential diagnostic PCR to detect and distinguish the rat coronavirus from mouse coronaviruses. |A1:**1MP3E3| |A2:**1SP3E3| |A3:**1MP3E1| |A4:**1MP3E3| |A5:**1SP3E3|
				Annotation	1MP3E3	1SP3E3	1MP3E1	1MP3E3	1SP3E3
				Evidence	4	4	2	4	4
				Focus	2	4	2	2	4
				Polarity	7	7	7	7	7
996	9402	9603885_216	The situation with cheA closely resembles the present one in that the second start exists at the 3' end of the loop of a stem-loop structure ( 8), |A1:**1SP3E2| |A2:**1SP3E2| |A3:**1SP2E2| |A4:**1SP2E2| the second start and the stem-loop structure are both present in both E. coli and S. typhimurium, and the stem-loops are divergent in their details. |A1:**2SP3E0| |A2:**2SP3E0| |A3:**2SP2E0| |A4:**2SP2E0| |A5:**1SP3E2|
				Annotation	1SP3E2 2SP3E0	1SP3E2 2SP3E0	1SP2E2 2SP2E0	1SP2E2 2SP2E0	1SP3E2 1SP3E2
				Evidence	3 1	3 1	3 1	3 1	3 3
				Focus	4 4	4 4	4 4	4 4	4 4
				Polarity	7 7	7 7	6 6	6 6	7 7
997	5554	12172074_3	Although heat stroke is not a common admission diagnosis for inpatient rehabilitation, |A3:**1SN3E0| |A4:**1SN3E0| |A5:**1GN3E0| physiatrists need to be aware of its pathophysiology, rehabilitation management, and prevention. |A3:**2SP3E0| |A1:**1GN2E0| |A2:**1GN2E0| |A4:**2GP3E0| |A5:**2GP3E0|
				Annotation	1GN2E0 1GN2E0	1GN2E0 1GN2E0	1SN3E0 2SP3E0	1SN3E0 2GP3E0	1GN3E0 2GP3E0
				Evidence	1 1	1 1	1 1	1 1	1 1
				Focus	1 1	1 1	4 4	4 1	1 1
				Polarity	2 2	2 2	1 7	1 7	1 7
998	5968	9817748_48	In the course of further characterization of the nuclear import of Lhp1p via Kap108p, we have now identified an evolutionary divergence in the pathway of nuclear import of La proteins. |A1:**1SP3E3| |A2:**1SP3E3| |A3:**1SP3E1| |A4:**1SP3E1| |A5:**1SP3E3|
				Annotation	1SP3E3	1SP3E3	1SP3E1	1SP3E1	1SP3E3
				Evidence	4	4	2	2	4
				Focus	4	4	4	4	4
				Polarity	7	7	7	7	7
999	1201	11533226_170	Batches of 10 unfertilized eggs or embryos were sampled; lysed at 0 (unfertilized eggs), 1, 2, or 3 h postfertilization (hpf); and analyzed by SDS-PAGE along with a whole-cell lysate from A6 cells. |A1:**1MP3E3| |A2:**1MP3E3| |A3:**1MP3E1| |A4:**1MP3E1| |A5:**1MP3E3|
				Annotation	1MP3E3	1MP3E3	1MP3E1	1MP3E1	1MP3E3
				Evidence	4	4	2	2	4
				Focus	2	2	2	2	2
				Polarity	7	7	7	7	7
1000	2364	10768986_158	Strain mc22032 failed to grow on minimal agar or in minimal broth (Fig. 2). |A1:**1SN3E3| |A2:**1SN3E3| |A3:**1SP3E3-| |A4:**1SP3E3-| |A5:**1GN3E3|
				Annotation	1SN3E3	1SN3E3	1SP3E3-	1SP3E3-	1GN3E3
				Evidence	4	4	4	4	4
				Focus	4	4	4	4	1
				Polarity	1	1	7	7	1